Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Coffea canephora #1
It has been superseded by SGN-U625452 in the current build, Coffea canephora #3
Unigene SGN-U309572

Unigene Basic Information 
Unigene ID: SGN-U309572
Unigene Build: Coffea canephora #1
Date: 2005-04-24
Organism: C.canephora
Alternative ID: 129107
mRNA sequence: Length: 365 bp

>SGN-U309572 Coffea canephora #1 (1 members)
GCTGAAATTGCAGTGGAGCTGGAGTCTGCCTTTATGTCGACCATTTACTGAATGAGTCATCTGAAGAAGTTAGAAAACTTCGAGGATATA
TGTATTCTTACAAGGCCAGTTAAGTTCCACTTGGATCATTGTTAAAAATGAACAGATAAAACACATACACGACAATCTTCTGATTCTTCA
GTGAAGAGAAGTTGGCTTATTTGGCAAGAGGACCGGCTTCACTGGTCCTCAAGTCGAATGGTTACTTTGTAGAACGGTTACTTGTCAAGA
TGCATCATTTTCCATGGTAGAAGCATCTTGTCTTGGTGATTGTAAAGTCAACTAGTGCACATCCTAACATAGCTTAGCTCGTCTGACTGT
TTCAC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E634425
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (0)None