Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Unigene SGN-U445095

Unigene Basic Information 
Unigene ID: SGN-U445095
Unigene Build: Nicotiana tabacum #2
Date: 2008-07-17
Organism: N.tabacum
Alternative ID: none
mRNA sequence: Length: 918 bp

>SGN-U445095 Nicotiana tabacum #2 (41 members)
ATTACGGCCGGGGGATTACGGCCGGGGCAGGAACATTCAGAAATGGCTTCTTCTACTCTTTCTCCAGTAACTCAGCTATGCTCAAGCAAG
AGTGGCTTGTCTTCAGTTTCACAATGTTTGCTAGTGAAGCCAATGAAGATTAACAGTCATGGATTGGGAAAAGATAAGAGGATGAAAGTG
AAATGCATGGCTACAAGTATTCCAGCAGATGATAGAGTGCCTGATATGGAAAAGAGGAATCTCATGAATTTGCTTCTTTTGGGTGCTCTT
TCTCTACCCACTGCTGGGATGTTGGTACCTTATGGTACTTTCTTTGTACCACCTGGGTCAGGGGGTGGTAGTGGTGGAACCCCTGCCAAG
GATGCATTAGGTAATGATGTCATTGCATCTGAATGGCTCAAAACTCATCCACCTGGCAACCGAACTCTCACGCAAGGACTAAAGGGAGAC
CCTACTTATCTTGTTGTGGAGAATGATGGAACACTTGCAACCTATGGTATTAATGCTGTGTGTACTCACCTTGGTTGTGTTGTGCCATTT
AATGCTGCTGAGAACAAGTTTATTTGCCCCTGCCATGGATCTCAATACAACAACCAAGGAAGAGTTGTTAGAGGACCTGCTCCTTTGTCC
TTGGCATTGGCTCATGCTGATATTGATGATGGGAAGGTGGTGTTTGTCCCATGGGTTGAAACAGACTTCAGAACTGGTGAAGATCCATGG
TGGGCTTAGATCTCCTTATCACTATATTATCCTCTTGTATCTTTGTTACATAAAGCTTATCTCCTTTTTATGAAGTAAAAAGAAATATTC
ATTTTGAGATGTAACTATTGAAGCATAACCTTTGCAGTCCCATAATGACATTTTTTGTTTAAGATACAACTATTTCATTTGTTTATATAT
AACTTTATGTACATTGCC


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
petC1 chloroplast Rieske FeS precursor protein 1
petC2 chloroplast Rieske FeS precursor protein 2cytochrome
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (41)  
Alignment image suppressed for unigene with 41 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)