Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Unigene SGN-U593389

Unigene Basic Information 
Unigene ID: SGN-U593389
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 413 bp

>SGN-U593389 Tomato 200607 #2 (1 members)
GAAGGACACGGTGAAGACATGGGTAATTTCTATTCAGCTGGTTTAGACCCGCTTTTCTACTGTCACCATGCTAATGTGGACAGGATGTGG
AACGAGTGGAAATTAATTGGCGGGAAAAGAAGGGATTTATCAAATAAAGATTGGTTGAACTCTGAATTCTTTTTCTACGATGAAAATCGT
AACCCTTACCGCGTGAAAGTCCGTGATTGTTTGGATAGTAAAAAAATGGGATTCGATTACGCGCCAATGCCCACTCCATGGCGTAATTTC
AAACCAATCAGAAGGTGTTCCCACTGGCCAAGCTGGACCGTGCGATTTCGTTCTCGATCACGCGGCCAGCTTCGTCAAGGACAACACAAG
AGAAAAATGAGCAGGAGGAGATTCTGACATTCAATAAAATGGCATATGATGAT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc08g074630 Solyc08g074630
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E313009
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)