Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U578360 and SGN-U581289 in the current build, Tomato 200607 #2
Unigene SGN-U144813

Unigene Basic Information 
Unigene ID: SGN-U144813
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 144813
mRNA sequence: Length: 685 bp

>SGN-U144813 Lycopersicon Combined #2 (7 members)
AGCAAGCAAGCATTTTCTTAGTGTTTATTTTACTATAATTTTTTTTTTTTGTTATAAATTTAAAAAATGCCTTGCATAGCTTTTGGACGA
TTCGATGATTCATTCAGCTTAGGGTCTATTAAGGCCTATATTGCTGAATTCATCTCTACTTTGCTCTTTGTCTTCGCCGGAGTTGGTTCA
GCTATTGCTTACAACAAGGTGACAGCTGATGCTGCTCTTGATCCGTCTGGGCTAGTAGCTGTTGCAGTTTGCCATGGATTCGCACTGTTC
GTGGCTGTTGCCATTGCTGCTAATATCTCCGGTGGTCACGTCAACCCTGCCGTCACATTCGGATTGGCTCTCGGTGGCCAAATCACCCTC
CTCACCGGTCTATTTTACTGGATTGCTCAACTTTTGGGTGCAATTGTTGGCTGTTACCTTCTCAAAGTTGTGACTGGAGGAATGGCGGTT
CCGATCCACGGTGTGGCTGCTGGAGTAGGAGCTGCCGAAGGAGTGGTGATGGAAATAATCATTACATTTGCTTTGGTGTACACAGTGTAC
GCCACAGCAGCTGACCCATAGCGATCGGTTTCATTGGTGGTGCTAATATTTTAGCTGCAGGCCCGTTCTCTGGAGGTTCAATGAACCCAG
CCCGTTCATTTGGACCCGCTGTGGTTAGTGGAAACTTTGCTGGTATTTGGATTTA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (7)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None