This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U586035 and SGN-U586037 in the current build, Tomato 200607 #2
Unigene SGN-U214011

Unigene Basic Information 
Unigene ID: SGN-U214011
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 214011
mRNA sequence: Length: 1988 bp

>SGN-U214011 Lycopersicon Combined #3 (39 members)
ACATCTCCCTTTTCTGACATTTTACTTTAGCTGTCACAATTCTGATGGCCGACACTTCTAGTACCTCCGGTATCACCAGTAGCACCGCCG
CTTCTACGACGGCAAACCCACCGGAATCCAAAAGTTGGGCAGACCAAGTCGACGAGATCGATCAAGCTGAGCAGTCGGCAGACCAAGCTG
AGCAGTCTTCCGCTTCGAACGAAGAAGGCGCTACTGCCGAGATAAATATCGGATCTTTACAAGTCGATGAGTCCAAAAGAGAAAACTCCA
CTCTCTCTGAGCCGGAAGATTCAAGCATACAAGCGGTTACATCTGGCGATACTATGTACAAATCAGCGAAGAGATTTGAGGATTTGAACT
TATCTCCTGAGCTATTGAAGGGATTATATGTACAAATGCAGTTTGAGCGTCCTAGCAAGATTCAGGAAATTAGTTTGCCTATGATTCTTA
CGCCTCCCTACAAGAATCTTATTGCTCAGGCTCATAATGGTTCTGGTAAAACTACTTGCTTTGTGCTTGGGATGTTGAGTCGGATTGATC
CAAAGCTTGCTGCCCCTCAAGCTCTCTGTATCTGTCCAACCAGAGAATTGGCTATTCAGAATATGGAAGTGCTATTGAAGATGGGGAAGT
TCACTGGCATAACATCAGAGTTAGGTATCCCAGCAGATTCTGCCAACTATATTCCAATTTCGAAACGGCCGCCTGTCACGGCACAAGTAG
TGATTGGCACACCTGGGACTATAAACAAGTGGGTGACGGCAAGGAAACTGGGCATGAGTTGTATGAAAATTCTTGTGTTTGATGAAGCGG
ACCACATGTTGGCAGAGAGTGGTTTTCAGGATGATTCCATAAGAATAATGAAGGCAATCGTTAAAGCCAGCGCTAACTGCCAGGTGCTTC
TGTTTTCTGCAACGTTTGGGGAAAATGTCAAAGCATTTGTGACAAAAATTGTTCAAGATCTTTTTGTGCAAGATTACAATCAAATGTTTG
TGAAGAAAGAAGAACTTTCACTGGATTCAGTGAAGCAGTATAAAGTGCAGTGTCCGGACGAACTTTCAAAAATCATGGTGATTAAAGACA
GAATACTAGAACTAGGACAGAAGGTGGGGCAAACAATTATATTTGTTCGTACCAGAAACAGTGCAAGTATGTTGCATAAGTCATTGGTTG
ACTATGGCTATGAAGTGACAACAATTCAAGGTGCTCTTAGGCAAGAAGACAGAGACAAAATAATCAAGGAGTTCAAAGATGGATTGACAC
AAATTCTTATATCAACTGATCTTCTTGCTCGTGGATTTGACCAATCACAGGTTAATTTGGTGGTTAATTATGACCTCCCTGTGAGACACG
AGAGTCCAACAGAGCCAGATCATGAGGTATACCTGCATCGGATTGGTAGAGCAGGACGTTTTGGACGCAAGGGTGCGATATTCAACTTGC
TGTGCAGTGACAGAGACAACATGCTAATGTCAAAGATTGAGAACCATTTCAACCATCAAGTGGCTGAGATTCCCTCATGGAGTAATGAAG
AAGATTTCGAAAATGCTCTGAAGATAGCTGGCTTGCTGTAAGCCGAGTAGAATGTTGGTTAACAGTTCTCAGGAGATATGCTCGCTCGCT
CTACTTATTTCGATCTTTCCACTGTTGAGTTTTGACAACATCTATATATTTCACTGAAGCAGCATCAGCAATATAGACTCCGTTTATAGT
GATCGAGTTTTGTCCAGTCTGTATTTTTTTCTTAATGTCTTGTTATATTCATCGACTTCGAGTAAAACAACCGTGATGACATTTGTATAG
TTGACAGAGCAGTGCTCCTGAAAGGCTTTTCTTCTTTGATTGCTGTCATGCTTCACTTACCATTTCTGGTGTTACAAGTTCTCAAAATAC
ACTGTCAAAAGGAACTAAATTTTTTTAGATGTCACATGAACATGTGACGAAAGATAATTATATTTTACTTTTTAGATGCTAAAAAAAAAA
AAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (39)  
Alignment image suppressed for unigene with 39 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (4)  
Annotations (manual: 1 | blast: 2 | go: 4 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)