This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.
Tomato locus 1-aminocyclopropane-1-carboxylic acid synthase-2
| Locus details | Download GMOD XML | Note to Editors | Annotation guidelines |
[loading edit links...]
|
[loading...]
|
|
Links to external databases
Links to external databases
|
1-aminocyclopropane-1-carboxylic acid synthase-2 is on PhyloGenes
TomDelDB genotype frequencies in tomato populations. chromosome SL2.50ch01, position: 86453656
Please cite Razifard et al.
| Registry name: | None | [Associate registry name] |
Notes and figures (0)
Notes and figures (0)
| [Add notes, figures or images] |
Success
The display image was set successfully.
| Image | Description | Type |
|---|
Accessions and images (0)
Accessions and images (0)
| [Associate accession] |
Accession name:
Would you Like to specify an allele?
| Alleles (0) | None | [Add new Allele] |
Associated loci (8)
Associated loci (8)
| [Associate new locus] |
[loading...]
|
Associated loci - graphical view
Associated loci - graphical view
| View 1-aminocyclopropane-1-carboxylic acid synthase-2 relationships in the stand-alone network browser |
[loading...] | [Legend] [Levels] |
SolCyc links
SolCyc links
|
[loading...]
Sequence annotations
Sequence annotations
|
Genome features
Genome features
|
Genomic sequence
Genomic sequence
| unprocessed genomic sequence region underlying this gene |
>Solyc01g095080.2 SL2.50ch01:86456196..86453267 (sequence from reverse strand)
TTCCTTAATTCTCTTACACCATAACACAACTACAACAAACACATAATACTTTTAATACAATTAGTTATTTATTAGAAGTATTTAAAGTAAAGCACTTGTGAGTTGTGTACATTTTATTAATCTTCATCTTCTTAATTCTCTTCAGTTTTTAATTTCTTCACTTCTAAACTCATTTAGTAAAAAAAAATGGGATTTGAGATTGCAAAGACCAACTCAATCTTATCAAAATTGGCTACTAATGAAGAGCATGGCGAAAACTCGCCATATTTTGATGGGTGGAAAGCATACGATAGTGATCCTTTCCACCCTCTAAAAAACCCCAACGGAGTTATCCAAATGGGTCTTGCTGAAAATCAGGTAATTAATTATCCTTTATTTATATATTTTGCAGTTTGACCAAACAGACTATTATAATTTTTTTCTGAAACCTCGATGGTGTTAAATTTCTTTTGTAGCTTTGTTTAGACTTGATAGAAGATTGGATTAAGAGAAACCCAAAAGGTTCAATTTGTTCTGAAGGAATCAAATCATTCAAGGCCATTGCCAACTTTCAAGATTATCATGGCTTGCCTGAATTCAGAAAAGTACATATCGTACTATAGTCAGTTAAATTATATTGATAGTATAAAAATTCGTTAATATATTTAACTAACGAGTTTATTTAATCAGGCGATTGCGAAATTTATGGAGAAAACAAGAGGAGGAAGAGTTAGATTTGATCCAGAAAGAGTTGTTATGGCTGGTGGTGCCACTGGAGCTAATGAGACAATTATATTTTGTTTGGCTGATCCTGGCGATGCATTTTTAGTACCTTCACCATACTACCCAGCGTAAGTATATTTAATTATATATGTGTAAAAAAAATTAAAATCATCAAATCATTTTTTTTATTTGTATTACCAAATAAATTGTCTAATTTTCAAGATTGTAACACATTCATCAAAGTACCTAATAATATAAACGATTCAGTATATTAACGATGTATATAATTTAATTCCTTTGGCGGATTTGTCTTTTTATGTTGGGCCATCAGAAGAACATTCTGGTGTATTAATTAATTAATTAATTAATAATAGATGTGTTGTCATTCTTTTTTAAGACAGCGAGAGTTTAATTAGTCTTAATTACTGGATTATCACGCAAGCTCTTTCTTGAATTTTATTATTCTTATATTAAACACATGATAGCATAATATCTTTCTTTTGTGGAATCCAGCTTGTTCGTGAAGCTTTGTATTCACACTTATAAAACAACAAAAAATAAAATCTGGTGGTAATTGATTAAAGAGAGAAATATAAAAAAATAATAGTCAAATAGACTAATAAGGAAAGAAATAAAAAATACACAAAATACTAAAAAAAAAGAATTAAGGTATAGTGGTCTATTATTGAGAACTTTTTTGAAGAATTGAACCCCACTTTAATTTCTTGCTTGACCCGTGACCATTGCTTATCGAGGTAAAATAAAATTTCAAACATTGACTATGACTTGTTAGAGAGTAATTACCACAAGTCAAAATTTTGTTACTCTGTCTCGTTATTTCATTAGGATCGATAAGATAACATCTAACATATATATCTTTTTTATTAGTACTTGTTTATTTTTAGTAAAAGCACGTTATACATTTTACAATAGTCAATTGTTGCATATATTAGTATATATATTTTGCTAAGTCCTAACTAACAATATTTTTGGCAATTGACTAATGCAGATTTAACAGAGATTTAAGATGGAGAACTGGAGTACAACTTATTCCAATTCACTGTGAGAGCTCCAATAATTTCAAAATTACTTCAAAAGCAGTAAAAGAAGCATATGAAAATGCACAAAAATCAAACATCAAAGTAAAAGGTTTGATTTTGACCAATCCATCAAATCCATTGGGCACCACTTTGGACAAAGACACACTGAAAAGTGTCTTGAGTTTCACCAACCAACACAACATCCACCTTGTTTGTGACGAAATCTACGCAGCCACTGTCTTTGACACGCCTCAATTCGTCAGTATAGCTGAAATCCTCGATGAACAGGAAATGACTTACTGCAACAAAGATTTAGTTCACATCGTCTACAGTCTTTCAAAAGACATGGGGTTACCAGGATTTAGAGTCGGAATCATATATTCTTTTAACGACGATGTCGTTAATTGTGCTAGAAAAATGTCGAGTTTCGGTTTAGTATCTACACAAACGCAATATTTTTTAGCGGCAATGCTATCGGACGAAAAATTCGTCGATAATTTTCTAAGAGAAAGCGCGATGAGGTTAGGTAAAAGGCACAAACATTTTACTAATGGACTTGAAGTAGTGGGAATTAAATGCTTGAAAAATAATGCGGGGCTTTTTTGTTGGATGGATTTGCGTCCACTTTTAAGGGAATCGACTTTCGATAGCGAAATGTCGTTATGGAGAGTTATTATAAACGATGTTAAGCTTAACGTCTCGCCTGGATCTTCGTTTGAATGTCAAGAGCCAGGGTGGTTCCGAGTTTGTTTTGCAAATATGGATGATGGAACGGTTGATATTGCGCTCGCGAGGATTCGGAGGTTCGTAGGTGTTGAGAAAAGTGGAGATAAATCGAGTTCGATGGAAAAGAAGCAACAATGGAAGAAGAATAATTTGAGACTTAGTTTTTCGAAAAGAATGTATGATGAAAGTGTTTTGTCACCACTTTCGTCACCTATTCCTCCCTCACCATTAGTTCGTTAAGACTTAATTAAAAGGGAAGAATTTAATTTATGTTTTTTTATATTTTGAAAAAAATTTGTAAGAATAAGATTATAATAGGAAAAGAAAATAAGTATGTAGGATGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGGTCTATGTACTTAGACATCATAATTTGTCTTAGCTAATTAATGAATGCAAAAGTGAAGTTATGTTATGACTCTT
TTCCTTAATTCTCTTACACCATAACACAACTACAACAAACACATAATACTTTTAATACAATTAGTTATTTATTAGAAGTATTTAAAGTAAAGCACTTGTGAGTTGTGTACATTTTATTAATCTTCATCTTCTTAATTCTCTTCAGTTTTTAATTTCTTCACTTCTAAACTCATTTAGTAAAAAAAAATGGGATTTGAGATTGCAAAGACCAACTCAATCTTATCAAAATTGGCTACTAATGAAGAGCATGGCGAAAACTCGCCATATTTTGATGGGTGGAAAGCATACGATAGTGATCCTTTCCACCCTCTAAAAAACCCCAACGGAGTTATCCAAATGGGTCTTGCTGAAAATCAGGTAATTAATTATCCTTTATTTATATATTTTGCAGTTTGACCAAACAGACTATTATAATTTTTTTCTGAAACCTCGATGGTGTTAAATTTCTTTTGTAGCTTTGTTTAGACTTGATAGAAGATTGGATTAAGAGAAACCCAAAAGGTTCAATTTGTTCTGAAGGAATCAAATCATTCAAGGCCATTGCCAACTTTCAAGATTATCATGGCTTGCCTGAATTCAGAAAAGTACATATCGTACTATAGTCAGTTAAATTATATTGATAGTATAAAAATTCGTTAATATATTTAACTAACGAGTTTATTTAATCAGGCGATTGCGAAATTTATGGAGAAAACAAGAGGAGGAAGAGTTAGATTTGATCCAGAAAGAGTTGTTATGGCTGGTGGTGCCACTGGAGCTAATGAGACAATTATATTTTGTTTGGCTGATCCTGGCGATGCATTTTTAGTACCTTCACCATACTACCCAGCGTAAGTATATTTAATTATATATGTGTAAAAAAAATTAAAATCATCAAATCATTTTTTTTATTTGTATTACCAAATAAATTGTCTAATTTTCAAGATTGTAACACATTCATCAAAGTACCTAATAATATAAACGATTCAGTATATTAACGATGTATATAATTTAATTCCTTTGGCGGATTTGTCTTTTTATGTTGGGCCATCAGAAGAACATTCTGGTGTATTAATTAATTAATTAATTAATAATAGATGTGTTGTCATTCTTTTTTAAGACAGCGAGAGTTTAATTAGTCTTAATTACTGGATTATCACGCAAGCTCTTTCTTGAATTTTATTATTCTTATATTAAACACATGATAGCATAATATCTTTCTTTTGTGGAATCCAGCTTGTTCGTGAAGCTTTGTATTCACACTTATAAAACAACAAAAAATAAAATCTGGTGGTAATTGATTAAAGAGAGAAATATAAAAAAATAATAGTCAAATAGACTAATAAGGAAAGAAATAAAAAATACACAAAATACTAAAAAAAAAGAATTAAGGTATAGTGGTCTATTATTGAGAACTTTTTTGAAGAATTGAACCCCACTTTAATTTCTTGCTTGACCCGTGACCATTGCTTATCGAGGTAAAATAAAATTTCAAACATTGACTATGACTTGTTAGAGAGTAATTACCACAAGTCAAAATTTTGTTACTCTGTCTCGTTATTTCATTAGGATCGATAAGATAACATCTAACATATATATCTTTTTTATTAGTACTTGTTTATTTTTAGTAAAAGCACGTTATACATTTTACAATAGTCAATTGTTGCATATATTAGTATATATATTTTGCTAAGTCCTAACTAACAATATTTTTGGCAATTGACTAATGCAGATTTAACAGAGATTTAAGATGGAGAACTGGAGTACAACTTATTCCAATTCACTGTGAGAGCTCCAATAATTTCAAAATTACTTCAAAAGCAGTAAAAGAAGCATATGAAAATGCACAAAAATCAAACATCAAAGTAAAAGGTTTGATTTTGACCAATCCATCAAATCCATTGGGCACCACTTTGGACAAAGACACACTGAAAAGTGTCTTGAGTTTCACCAACCAACACAACATCCACCTTGTTTGTGACGAAATCTACGCAGCCACTGTCTTTGACACGCCTCAATTCGTCAGTATAGCTGAAATCCTCGATGAACAGGAAATGACTTACTGCAACAAAGATTTAGTTCACATCGTCTACAGTCTTTCAAAAGACATGGGGTTACCAGGATTTAGAGTCGGAATCATATATTCTTTTAACGACGATGTCGTTAATTGTGCTAGAAAAATGTCGAGTTTCGGTTTAGTATCTACACAAACGCAATATTTTTTAGCGGCAATGCTATCGGACGAAAAATTCGTCGATAATTTTCTAAGAGAAAGCGCGATGAGGTTAGGTAAAAGGCACAAACATTTTACTAATGGACTTGAAGTAGTGGGAATTAAATGCTTGAAAAATAATGCGGGGCTTTTTTGTTGGATGGATTTGCGTCCACTTTTAAGGGAATCGACTTTCGATAGCGAAATGTCGTTATGGAGAGTTATTATAAACGATGTTAAGCTTAACGTCTCGCCTGGATCTTCGTTTGAATGTCAAGAGCCAGGGTGGTTCCGAGTTTGTTTTGCAAATATGGATGATGGAACGGTTGATATTGCGCTCGCGAGGATTCGGAGGTTCGTAGGTGTTGAGAAAAGTGGAGATAAATCGAGTTCGATGGAAAAGAAGCAACAATGGAAGAAGAATAATTTGAGACTTAGTTTTTCGAAAAGAATGTATGATGAAAGTGTTTTGTCACCACTTTCGTCACCTATTCCTCCCTCACCATTAGTTCGTTAAGACTTAATTAAAAGGGAAGAATTTAATTTATGTTTTTTTATATTTTGAAAAAAATTTGTAAGAATAAGATTATAATAGGAAAAGAAAATAAGTATGTAGGATGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGGTCTATGTACTTAGACATCATAATTTGTCTTAGCTAATTAATGAATGCAAAAGTGAAGTTATGTTATGACTCTT
| Download sequence region |
Get flanking sequences on SL2.50ch01
|
mRNA Solyc01g095080.2.1
mRNA Solyc01g095080.2.1
|
Ontology terms
Ontology terms
| terms associated with this mRNA |
cDNA sequence
cDNA sequence
| spliced cDNA sequence, including UTRs |
>Solyc01g095080.2.1 1-aminocyclopropane-1-carboxylate synthase (AHRD V1 **** O65209_NICGU); contains Interpro domain(s) IPR004839 Aminotransferase, class I and II IPR004838 Aminotransferases, class-I, pyridoxal-phosphate-binding site
TTCCTTAATTCTCTTACACCATAACACAACTACAACAAACACATAATACTTTTAATACAATTAGTTATTTATTAGAAGTATTTAAAGTAAAGCACTTGTGAGTTGTGTACATTTTATTAATCTTCATCTTCTTAATTCTCTTCAGTTTTTAATTTCTTCACTTCTAAACTCATTTAGTAAAAAAAAATGGGATTTGAGATTGCAAAGACCAACTCAATCTTATCAAAATTGGCTACTAATGAAGAGCATGGCGAAAACTCGCCATATTTTGATGGGTGGAAAGCATACGATAGTGATCCTTTCCACCCTCTAAAAAACCCCAACGGAGTTATCCAAATGGGTCTTGCTGAAAATCAGCTTTGTTTAGACTTGATAGAAGATTGGATTAAGAGAAACCCAAAAGGTTCAATTTGTTCTGAAGGAATCAAATCATTCAAGGCCATTGCCAACTTTCAAGATTATCATGGCTTGCCTGAATTCAGAAAAGCGATTGCGAAATTTATGGAGAAAACAAGAGGAGGAAGAGTTAGATTTGATCCAGAAAGAGTTGTTATGGCTGGTGGTGCCACTGGAGCTAATGAGACAATTATATTTTGTTTGGCTGATCCTGGCGATGCATTTTTAGTACCTTCACCATACTACCCAGCATTTAACAGAGATTTAAGATGGAGAACTGGAGTACAACTTATTCCAATTCACTGTGAGAGCTCCAATAATTTCAAAATTACTTCAAAAGCAGTAAAAGAAGCATATGAAAATGCACAAAAATCAAACATCAAAGTAAAAGGTTTGATTTTGACCAATCCATCAAATCCATTGGGCACCACTTTGGACAAAGACACACTGAAAAGTGTCTTGAGTTTCACCAACCAACACAACATCCACCTTGTTTGTGACGAAATCTACGCAGCCACTGTCTTTGACACGCCTCAATTCGTCAGTATAGCTGAAATCCTCGATGAACAGGAAATGACTTACTGCAACAAAGATTTAGTTCACATCGTCTACAGTCTTTCAAAAGACATGGGGTTACCAGGATTTAGAGTCGGAATCATATATTCTTTTAACGACGATGTCGTTAATTGTGCTAGAAAAATGTCGAGTTTCGGTTTAGTATCTACACAAACGCAATATTTTTTAGCGGCAATGCTATCGGACGAAAAATTCGTCGATAATTTTCTAAGAGAAAGCGCGATGAGGTTAGGTAAAAGGCACAAACATTTTACTAATGGACTTGAAGTAGTGGGAATTAAATGCTTGAAAAATAATGCGGGGCTTTTTTGTTGGATGGATTTGCGTCCACTTTTAAGGGAATCGACTTTCGATAGCGAAATGTCGTTATGGAGAGTTATTATAAACGATGTTAAGCTTAACGTCTCGCCTGGATCTTCGTTTGAATGTCAAGAGCCAGGGTGGTTCCGAGTTTGTTTTGCAAATATGGATGATGGAACGGTTGATATTGCGCTCGCGAGGATTCGGAGGTTCGTAGGTGTTGAGAAAAGTGGAGATAAATCGAGTTCGATGGAAAAGAAGCAACAATGGAAGAAGAATAATTTGAGACTTAGTTTTTCGAAAAGAATGTATGATGAAAGTGTTTTGTCACCACTTTCGTCACCTATTCCTCCCTCACCATTAGTTCGTTAAGACTTAATTAAAAGGGAAGAATTTAATTTATGTTTTTTTATATTTTGAAAAAAATTTGTAAGAATAAGATTATAATAGGAAAAGAAAATAAGTATGTAGGATGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGGTCTATGTACTTAGACATCATAATTTGTCTTAGCTAATTAATGAATGCAAAAGTGAAGTTATGTTATGACTCTT
TTCCTTAATTCTCTTACACCATAACACAACTACAACAAACACATAATACTTTTAATACAATTAGTTATTTATTAGAAGTATTTAAAGTAAAGCACTTGTGAGTTGTGTACATTTTATTAATCTTCATCTTCTTAATTCTCTTCAGTTTTTAATTTCTTCACTTCTAAACTCATTTAGTAAAAAAAAATGGGATTTGAGATTGCAAAGACCAACTCAATCTTATCAAAATTGGCTACTAATGAAGAGCATGGCGAAAACTCGCCATATTTTGATGGGTGGAAAGCATACGATAGTGATCCTTTCCACCCTCTAAAAAACCCCAACGGAGTTATCCAAATGGGTCTTGCTGAAAATCAGCTTTGTTTAGACTTGATAGAAGATTGGATTAAGAGAAACCCAAAAGGTTCAATTTGTTCTGAAGGAATCAAATCATTCAAGGCCATTGCCAACTTTCAAGATTATCATGGCTTGCCTGAATTCAGAAAAGCGATTGCGAAATTTATGGAGAAAACAAGAGGAGGAAGAGTTAGATTTGATCCAGAAAGAGTTGTTATGGCTGGTGGTGCCACTGGAGCTAATGAGACAATTATATTTTGTTTGGCTGATCCTGGCGATGCATTTTTAGTACCTTCACCATACTACCCAGCATTTAACAGAGATTTAAGATGGAGAACTGGAGTACAACTTATTCCAATTCACTGTGAGAGCTCCAATAATTTCAAAATTACTTCAAAAGCAGTAAAAGAAGCATATGAAAATGCACAAAAATCAAACATCAAAGTAAAAGGTTTGATTTTGACCAATCCATCAAATCCATTGGGCACCACTTTGGACAAAGACACACTGAAAAGTGTCTTGAGTTTCACCAACCAACACAACATCCACCTTGTTTGTGACGAAATCTACGCAGCCACTGTCTTTGACACGCCTCAATTCGTCAGTATAGCTGAAATCCTCGATGAACAGGAAATGACTTACTGCAACAAAGATTTAGTTCACATCGTCTACAGTCTTTCAAAAGACATGGGGTTACCAGGATTTAGAGTCGGAATCATATATTCTTTTAACGACGATGTCGTTAATTGTGCTAGAAAAATGTCGAGTTTCGGTTTAGTATCTACACAAACGCAATATTTTTTAGCGGCAATGCTATCGGACGAAAAATTCGTCGATAATTTTCTAAGAGAAAGCGCGATGAGGTTAGGTAAAAGGCACAAACATTTTACTAATGGACTTGAAGTAGTGGGAATTAAATGCTTGAAAAATAATGCGGGGCTTTTTTGTTGGATGGATTTGCGTCCACTTTTAAGGGAATCGACTTTCGATAGCGAAATGTCGTTATGGAGAGTTATTATAAACGATGTTAAGCTTAACGTCTCGCCTGGATCTTCGTTTGAATGTCAAGAGCCAGGGTGGTTCCGAGTTTGTTTTGCAAATATGGATGATGGAACGGTTGATATTGCGCTCGCGAGGATTCGGAGGTTCGTAGGTGTTGAGAAAAGTGGAGATAAATCGAGTTCGATGGAAAAGAAGCAACAATGGAAGAAGAATAATTTGAGACTTAGTTTTTCGAAAAGAATGTATGATGAAAGTGTTTTGTCACCACTTTCGTCACCTATTCCTCCCTCACCATTAGTTCGTTAAGACTTAATTAAAAGGGAAGAATTTAATTTATGTTTTTTTATATTTTGAAAAAAATTTGTAAGAATAAGATTATAATAGGAAAAGAAAATAAGTATGTAGGATGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGGTCTATGTACTTAGACATCATAATTTGTCTTAGCTAATTAATGAATGCAAAAGTGAAGTTATGTTATGACTCTT
Protein sequence
Protein sequence
| translated polypeptide sequence |
>Solyc01g095080.2.1 1-aminocyclopropane-1-carboxylate synthase (AHRD V1 **** O65209_NICGU); contains Interpro domain(s) IPR004839 Aminotransferase, class I and II IPR004838 Aminotransferases, class-I, pyridoxal-phosphate-binding site
MGFEIAKTNSILSKLATNEEHGENSPYFDGWKAYDSDPFHPLKNPNGVIQMGLAENQLCLDLIEDWIKRNPKGSICSEGIKSFKAIANFQDYHGLPEFRKAIAKFMEKTRGGRVRFDPERVVMAGGATGANETIIFCLADPGDAFLVPSPYYPAFNRDLRWRTGVQLIPIHCESSNNFKITSKAVKEAYENAQKSNIKVKGLILTNPSNPLGTTLDKDTLKSVLSFTNQHNIHLVCDEIYAATVFDTPQFVSIAEILDEQEMTYCNKDLVHIVYSLSKDMGLPGFRVGIIYSFNDDVVNCARKMSSFGLVSTQTQYFLAAMLSDEKFVDNFLRESAMRLGKRHKHFTNGLEVVGIKCLKNNAGLFCWMDLRPLLRESTFDSEMSLWRVIINDVKLNVSPGSSFECQEPGWFRVCFANMDDGTVDIALARIRRFVGVEKSGDKSSSMEKKQQWKKNNLRLSFSKRMYDESVLSPLSSPIPPSPLVR*
MGFEIAKTNSILSKLATNEEHGENSPYFDGWKAYDSDPFHPLKNPNGVIQMGLAENQLCLDLIEDWIKRNPKGSICSEGIKSFKAIANFQDYHGLPEFRKAIAKFMEKTRGGRVRFDPERVVMAGGATGANETIIFCLADPGDAFLVPSPYYPAFNRDLRWRTGVQLIPIHCESSNNFKITSKAVKEAYENAQKSNIKVKGLILTNPSNPLGTTLDKDTLKSVLSFTNQHNIHLVCDEIYAATVFDTPQFVSIAEILDEQEMTYCNKDLVHIVYSLSKDMGLPGFRVGIIYSFNDDVVNCARKMSSFGLVSTQTQYFLAAMLSDEKFVDNFLRESAMRLGKRHKHFTNGLEVVGIKCLKNNAGLFCWMDLRPLLRESTFDSEMSLWRVIINDVKLNVSPGSSFECQEPGWFRVCFANMDDGTVDIALARIRRFVGVEKSGDKSSSMEKKQQWKKNNLRLSFSKRMYDESVLSPLSSPIPPSPLVR*
Gene model matches
Gene model matches
|
SGN Unigenes
SGN Unigenes
| [Associate new unigene] |
Unigene ID:
[loading...]
GenBank accessions
GenBank accessions
| [Associate new genbank sequence] |
M34289 Tomato 1-aminocyclopropane-1-carboxylate synthase mRNA, complete cds.
M83318 Lycopersicon esculentum 1-aminocyclopropane-1-carboxylate homologue mRNA, partial cds.
X62536 L.esculentum mRNA for ACC synthase.
X59145 Lycopersicon esculentum LE-ASCC2 mRNA (ptACC2) for 1-aminocyclopropane-1-carboxylic acid synthase.
AY326958 Lycopersicon esculentum ripening-related ACC synthase 2 (ACS2) mRNA, complete cds.
AJ507012 Lycopersicon esculentum partial mRNA for putative 1-aminocyclopropane-1-carboxylate synthase (acs gene), cultivar Arka vikas.
M83318 Lycopersicon esculentum 1-aminocyclopropane-1-carboxylate homologue mRNA, partial cds.
X62536 L.esculentum mRNA for ACC synthase.
X59145 Lycopersicon esculentum LE-ASCC2 mRNA (ptACC2) for 1-aminocyclopropane-1-carboxylic acid synthase.
AY326958 Lycopersicon esculentum ripening-related ACC synthase 2 (ACS2) mRNA, complete cds.
AJ507012 Lycopersicon esculentum partial mRNA for putative 1-aminocyclopropane-1-carboxylate synthase (acs gene), cultivar Arka vikas.
| Other genome matches | None |
Literature annotations [8]
Literature annotations [8]
| [Associate publication] [Matching publications] |
Differential accumulation of transcripts for four tomato 1-aminocyclopropane-1-carboxylate synthase homologs under various conditions.
Proceedings of the National Academy of Sciences of the United States of America (1992)
Show / hide abstract
Show / hide abstract
Degenerate oligonucleotide primers corresponding to conserved regions flanking the active-site domain of 1-aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) were used for the polymerase chain reaction (PCR) to amplify DNA fragments from mRNA isolated from tomato fruit and tomato suspension cell culture. Antibodies raised against two conserved peptide sequences (TNPSNPLGTT and SLSKDLGLPGFRVG) were used to screen for positive colonies, after the PCR products were cloned into a Bluescript plasmid and expressed in Escherichia coli. Four distinct cDNA fragments encoding ACC synthase homologs were isolated. While pBTAS1 and pBTAS4 were obtained from fruit mRNA, cell culture mRNA yielded three sequences, pBTAS1, pBTAS2, and pBTAS3. Sequencing of these gene fragments revealed that pBTAS1 and pBTAS4 were identical to those full-length sequences previously reported by Van Der Straeten et al. [Van Der Straeten, D., Van Wiemeersch, L., Goodman, H. & Van Montague, M. (1990) Proc. Natl. Acad. Sci. USA 87, 4859-4863] and Olson et al. [Olson, D. C., White, J. A., Edelman, J., Harkin, R. N. & Kende, H. (1991) Proc. Natl. Acad. Sci. USA 88, 5340-5344] from tomato fruit, whereas pBTAS2 and pBTAS3 represent new sequences. Ribonuclease protection assays were used to examine the expression of these transcripts under three different conditions of enhanced ethylene production--namely, during fruit ripening, in response to mechanical wounding in fruit tissue, and auxin stimulation in vegetative tissue. Transcripts of pBTAS1 accumulated massively during ripening and wounding but only slightly in response to auxin treatment. Although pBTAS4 was associated with fruit ripening, it was unresponsive to auxin treatment in vegetative tissue. In contrast, the expression of pBTAS2 and pBTAS3 was greatly promoted in auxin-treated vegetative tissue but was absent from fruit tissue. While the expression of pBTAS2 was moderately dependent on wounding, pBTAS3 was unresponsive to wounding. These data support the view that ACC synthase is encoded by a multigene family and that the members are differentially expressed in response to developmental, environmental, and hormonal factors.
Yip, WK. Moore, T. Yang, SF.
Proceedings of the National Academy of Sciences of the United States of America.
1992.
89(6).
2475-9.
1-aminocyclopropane-1-carboxylate synthase in tomato is encoded by a multigene family whose transcription is induced during fruit and floral senescence.
Journal of molecular biology (1991)
Show / hide abstract
Show / hide abstract
The key regulatory enzyme in the biosynthetic pathway of the plant hormone ethylene is 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (EC 4.1.1.14). It catalyzes the conversion of S-adenosylmethionine to ACC, the precursor of ethylene. We isolated complementary DNA sequences, ptACC2 and ptACC4, for two distinct and differentially regulated ACC synthase mRNAs expressed in ripe tomato fruit. The authenticity of the clones has been confirmed by expression experiments in E. coli. The predicted size of the encoded polypeptides (54,690 and 53,519 Da) is similar to that of the primary in vitro translation products and to the proteins found in vivo. The sequence of the gene encoding one mRNA, LE-ACC2, has been determined and its transcription initiation site defined. Four additional genes, LE-ACC1A, LE-ACC1B, LE-ACC3 and LE-ACC4, have also been identified and the sequence of their coding regions determined. The LE-ACC1A and LE-ACC1B genes are adjacent to each other and are convergently transcribed. Their encoded polypeptides are 96% identical; the identity of the other polypeptides to each other varies between 50 and 70%. The proteins predicted to be encoded by the ACC synthase genes so far cloned from tomato and zucchini contain 11 of the 12 conserved amino acid residues found in various aminotransferases involved in the binding of the substrate and the cofactor pyridoxal-5'-phosphate. The data indicate that ACC synthase is encoded by a divergent multigene family in tomato that encodes proteins related to aminotransferases.
Rottmann, WH. Peter, GF. Oeller, PW. Keller, JA. Shen, NF. Nagy, BP. Taylor, LP. Campbell, AD. Theologis, A.
Journal of molecular biology.
1991.
222(4).
937-61.
Cloning and sequence of two different cDNAs encoding 1-aminocyclopropane-1-carboxylate synthase in tomato.
Proceedings of the National Academy of Sciences of the United States of America (1990)
Show / hide abstract
Show / hide abstract
1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14), the key enzyme in ethylene biosynthesis, was purified 5000-fold from induced tomato pericarp. ACC synthase activity was unambiguously correlated with a 45-kDa protein by two independent methods. Peptide sequences were obtained both from the N terminus after electroblotting and from tryptic peptides separated by reversed-phase chromatography. Mixed oligonucleotide probes were used to screen a lambda gt11 library prepared from RNA of induced pericarp tissue. Putative ACC synthase clones were isolated with a frequency of 0.01%. One of these contained a 1.9-kilobase insert with a single open reading frame encoding a polypeptide of 55 kDa. A second, partial cDNA clone was found that differed from the first one in 18% of its bases. Genomic Southern blotting suggests possible tandem organization of the two genes in tomato. The entire coding region was expressed in Escherichia coli and the denatured recombinant polypeptide was used to raise polyclonal antibodies. The antibody preparation both immunoinhibits and immunoprecipitates ACC synthase activity from an enriched tomato extract, confirming the identity of the clone. Northern blot analysis demonstrates that the ACC synthase messenger accumulation is coordinated with fruit ripening.
Van der Straeten, D. Van Wiemeersch, L. Goodman, HM. Van Montagu, M.
Proceedings of the National Academy of Sciences of the United States of America.
1990.
87(12).
4859-63.
Deletion of the carboxyl-terminal region of 1-aminocyclopropane-1-carboxylic acid synthase, a key protein in the biosynthesis of ethylene, results in catalytically hyperactive, monomeric enzyme.
The Journal of biological chemistry (1994)
Show / hide abstract
Show / hide abstract
1-Aminocyclopropane-1-carboxylic acid (ACC) synthase is a key enzyme regulating biosynthesis of the plant hormone ethylene. The expression of an enzymatically active, wound-inducible tomato (Lycopersicon esculentum L. cv Pik-Red) ACC synthase (485 amino acids long) in a heterologous Escherichia coli system allowed us to study the importance of hypervariable COOH terminus in enzymatic activity and protein conformation. We constructed several deletion mutants of the gene, expressed these in E. coli, purified the protein products to apparent homogeneity, and analyzed both conformation and enzyme kinetic parameters of the wild-type and truncated ACC syntheses. Deletion of the COOH terminus through Arg429 results in complete inactivation of the enzyme. Deletion of 46-52 amino acids from the COOH terminus results in an enzyme that has nine times higher affinity for the substrate S-adenosylmethionine than the wild-type enzyme. The highly efficient, truncated ACC synthase was found to be a monomer of 52 +/- 1.8 kDa as determined by gel filtration, whereas the wild-type ACC synthase, analyzed under similar conditions, is a dimer. These results demonstrate that the non-conserved COOH terminus of ACC synthase affects its enzymatic function as well as dimerization.
Li, N. Mattoo, AK.
The Journal of biological chemistry.
1994.
269(9).
6908-17.
Expression and internal feedback regulation of ACC synthase and ACC oxidase genes in ripening tomato fruit.
Plant & cell physiology (1997)
Show / hide abstract
Show / hide abstract
We have examined whether or not a positive feedback regulation of gene expression for 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase also operates in ripening tomato (Lycopersicon esculentum) fruit during the burst of ethylene production. Two cDNA fragments for ACC synthase and one for ACC oxidase were cloned with high homology to already known genes involved in ethylene biosynthesis in ripening tomato fruit. Accumulation of mRNAs which hybridize to these cDNA probes were induced in mature green fruit within two days by treatment with propylene. In the fruit ripened from the turning stage, red color development, ethylene production, ACC content, and activities of ACC synthase and ACC oxidase increased as maturity progressed. The abundance of two ACC synthase and one ACC oxidase mRNAs in the fruit increased from the turning to pink stage and were followed by a slight decline towards the red stage. These increases in mRNAs abundance with ripening were prevented to a large extent by treatment with the ethylene action inhibitor, 1-methylcyclopropene (MCP). This was most pronounced in the fruit treated with MCP at the turning stage, in which the accumulation of ACC synthase and ACC oxidase transcripts was almost completely eliminated in the first two d, precisely the same stage at which the control fruit had the greatest level of each mRNA accumulation. The inhibition of transcript accumulation recovered to the control level within two to four d. MCP also decreased ethylene biosynthetic activity, although this decrease did not reflect the reduction in the mRNAs accumulation. These results suggest that a strong positive feedback regulation is involved in ethylene biosynthesis at the gene transcriptional level in tomato fruit, even at the stage with a burst of ethylene production.
Nakatsuka, A. Shiomi, S. Kubo, Y. Inaba, A.
Plant & cell physiology.
1997.
38(10).
1103-10.
The role of ABA in triggering ethylene biosynthesis and ripening of tomato fruit.
Journal of experimental botany (2009)
Show / hide abstract
Show / hide abstract
In order to understand more details about the role of abscisic acid (ABA) in fruit ripening and senescence of tomato, two cDNAs (LeNCED1 and LeNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) as a key enzyme in ABA biosynthesis, two cDNAs (LeACS2 and LeACS4) which encode 1-aminocyclopropane-1-carboxylic acid (ACC) synthase, and one cDNA (LeACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from tomato fruit using a reverse transcription-PCR (RT-PCR) approach. The relationship between ABA and ethylene during ripening was also investigated. Among six sampling times in tomato fruits, the LeNCED1 gene was highly expressed only at the breaker stage when the ABA content becomes high. After this, the LeACS2, LeACS4, and LeACO1 genes were expressed with some delay. The change in pattern of ACO activity was in accordance with ethylene production reaching its peak at the pink stage. The maximum ABA content preceded ethylene production in both the seeds and the flesh. The peak value of ABA, ACC, and ACC oxidase activity, and ethylene production all started to increase earlier in seeds than in flesh tissues, although they occurred at different ripening stages. Exogenous ABA treatment increased the ABA content in both flesh and seed, inducing the expression of both ACS and ACO genes, and promoting ethylene synthesis and fruit ripening, while treatment with fluridone or nordihydroguaiaretic acid (NDGA) inhibited them, delaying fruit ripening and softening. Based on the results obtained in this study, it was concluded that LeNCED1 initiates ABA biosynthesis at the onset of fruit ripening, and might act as an original inducer, and ABA accumulation might play a key role in the regulation of ripeness and senescence of tomato fruit.
Zhang, M. Yuan, B. Leng, P.
Journal of experimental botany.
2009.
60(6).
1579-88.
Transcriptional regulation of the ethylene response factor LeERF2 in the expression of ethylene biosynthesis genes controls ethylene production in tomato and tobacco.
Plant physiology (2009)
Show / hide abstract
Show / hide abstract
Fine-tuning of ethylene production plays an important role in developmental processes and in plant responses to stress, but very little is known about the regulation of ethylene response factor (ERF) proteins in ethylene biosynthesis genes and ethylene production. Identifying cis-acting elements and transcription factors that play a role in this process, therefore, is important. Previously, a tomato (Solanum lycopersicum [f. sp. Lycopersicon esculentum]) ERF protein, LeERF2, an allele of TERF2, was reported to confer ethylene triple response on plants. This paper reports the transcriptional modulation of LeERF2/TERF2 in ethylene biosynthesis in tomato and tobacco (Nicotiana tabacum). Using overexpressing and antisense LeERF2/TERF2 transgenic tomato, we found that LeERF2/TERF2 is an important regulator in the expression of ethylene biosynthesis genes and the production of ethylene. Expression analysis revealed that LeERF2/TERF2 is ethylene inducible, and ethylene production stimulated by ethylene was suppressed in antisense LeERF2/TERF2 transgenic tomato, indicating LeERF2/TERF2 to be a positive regulator in the feedback loop of ethylene induction. Further research showed that LeERF2/TERF2 conservatively modulates ethylene biosynthesis in tobacco and that such regulation in tobacco is associated with the elongation of the hypocotyl and insensitivity to abscisic acid and glucose during germination and seedling development. The effects on ethylene synthesis were similar to those of another ERF protein, TERF1, because TERF1 and LeERF2/TERF2 have overlapping roles in the transcriptional regulation of ethylene biosynthesis in tobacco. Biochemical analysis showed that LeERF2/TERF2 interacted with GCC box in the promoter of NtACS3 and with dehydration-responsive element in the promoter of LeACO3, resulting in transcriptional activation of the genes for ethylene biosynthesis in tomato and tobacco, which is a novel regulatory function of ERF proteins in plant ethylene biosynthesis.
Zhang, Z. Zhang, H. Quan, R. Wang, XC. Huang, R.
Plant physiology.
2009.
150(1).
365-77.
A tomato MADS-box transcription factor, SlMADS1, acts as a negative regulator of fruit ripening.
Plant physiology (2014)
Show / hide abstract
Show / hide abstract
MADS-box genes encode a highly conserved gene family of transcriptional factors that regulate numerous developmental processes in plants. In this study, a tomato (Solanum lycopersicum) MADS-box gene, SlMADS1, was cloned and its tissue-specific expression profile was analyzed. The real-time polymerase chain reaction results showed that SlMADS1 was highly expressed in sepals and fruits; its expression level was increased with the development of sepals, while the transcript of SlMADS1 decreased significantly in accordance with fruit ripening. To further explore the function of SlMADS1, an RNA interference (RNAi) expression vector targeting SlMADS1 was constructed and transformed into tomato plants. Shorter ripening time of fruit was observed in SlMADS1-silenced tomatoes. The accumulation of carotenoid and the expression of PHYTOENE SYNTHETASE1 were enhanced in RNAi fruits. Besides, ethylene biosynthetic genes, including 1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE1A, 1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE6, 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE1, and 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE3, and the ethylene-responsive genes E4 and E8, which were involved in fruit ripening, were also up-regulated in silenced plants. SlMADS1 RNAi fruits showed approximately 2- to 4-fold increases in ethylene production compared with the wild type. Furthermore, SlMADS1-silenced seedlings displayed shorter hypocotyls and were more sensitive to 1-aminocyclopropane-1-carboxylate than the wild type. Additionally, a yeast two-hybrid assay revealed a clear interaction between SlMADS1 and SlMADS-RIN. These results suggest that SlMADS1 plays an important role in fruit ripening as a repressive modulator.
Dong, T. Hu, Z. Deng, L. Wang, Y. Zhu, M. Zhang, J. Chen, G.
Plant physiology.
2014.
163(2).
1026-36.
Ontology annotations (3)
Ontology annotations (3)
| [Add ontology annotations] |
[loading...]
Related views
Related views
|
- Genomic details
-
- AT1G01480.1 mRNA feature details
- AT1G01480.1 polypeptide feature details
- AT1G01480.2 mRNA feature details
- AT1G01480.2 polypeptide feature details
- AT5G36880.1 mRNA feature details
- AT5G36880.1 polypeptide feature details
- AT5G36880.2 mRNA feature details
- AT5G36880.2 polypeptide feature details
- Solyc01g095080.2 gene feature details
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Your Lists
Public Lists
List Contents
List Validation Report: Failed
Elements not found:
Optional: Add Missing Accessions to A List
Mismatched case
Click the Adjust Case button to align the case in the list with what is in the database.
Multiple mismatched case
Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.
List elements matching a synonym
Multiple synonym matches
Fuzzy Search Results
Synonym Search Results
Available Seedlots
List Comparison
Your Datasets
Public Datasets
Dataset Contents
Dataset Validation Failed
Elements not found:
Your Calendar
Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?
Add New Event
Event Info
| Attribute | Value |
|---|---|
| Project Name: | |
| Start Date: | |
| End Date: | |
| Event Type: | |
| Event Description: | |
| Event Web URL: |
Edit Event
Login
Forgot Username
If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.
Reset Password
To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.
Create New User
Working

Links to external databases
Links to external databases
