This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.
Tomato locus Pseudomonas syringae pv tomato resis.
| Locus details | Download GMOD XML | Note to Editors | Annotation guidelines |
[loading edit links...]
|
[loading...]
|
|
Links to external databases
Links to external databases
|
Pseudomonas syringae pv tomato resis. is a TGRC gene
Pseudomonas syringae pv tomato resis. is on PhyloGenes
TomDelDB genotype frequencies in tomato populations. chromosome SL2.50ch05, position: 6401781
Please cite Razifard et al.
| Registry name: | None | [Associate registry name] |
Notes and figures (1)
Notes and figures (1)
| [Add notes, figures or images] |
Success
The display image was set successfully.
Accessions and images (6)
Accessions and images (6)
| [Associate accession] |
Alleles (4)
Alleles (4)
| [Add new Allele] |
Associated loci (0)
Associated loci (0)
| [Associate new locus] |
[loading...]
|
| Associated loci - graphical view | None |
SolCyc links
SolCyc links
|
[loading...]
Sequence annotations
Sequence annotations
|
Genome features
Genome features
|
Genomic sequence
Genomic sequence
| unprocessed genomic sequence region underlying this gene |
>Solyc05g013300.1 SL2.50ch05:6401944..6400973 (sequence from reverse strand)
ATGGGAACCAACTATTCCAAGCCAACAACTTCCATAAATGATGCTTCCAATTTGAGTAATCGCGTTCCTTTTGAAAGTTTTCGAGTTCCTTTTGTAGATTTGCAGGAAGCAACTAATAACTTTGATGACAAGTTTCTGATTGGAGTGGGTATATTTGGTAAGGTTTACAGGGGTGTTTTGCGTGATGGTACAAAGGTGGCCCTGAAAAGACGTAAGCCTGAGTCTCCACAAGGTATTGAAGAGTTCCGAACAGAAATTGAGATACTCTCACACTGCAGCCATCCACATCTGGTTTCACTGATAGGATACTGTGATGAAAGAAATGAGATGATTCTAATTTATGACTACATGGAGAATGGGAACCTCAGTAAACGTTTGTATGGATCAGATCTATGTCTTCCCACTATGAGCTGGGAGCAGAGGCTGGAGATATGCATCGGGGCAGCCAGAGGTCTTCACTACCTTCATAACAGTGCAGTTATACATCGTGATGTCAAGTCTACAAACATATTGCTTGATGAGAATTTTGTGGCAAAAATTACTGATTTTGGAATATCCAAGACAACGCCTGAGTTTGATCAAACCCATCTTAGCACAATGGTGCAAGGAAGTATAGGCTACATTGACCCTGAATATTTTATAAGGGGACAACTGACAAAAAAATCTGATGTTTATTCTTTCGGTGTTGTTTTATTCGAAGTTCTTTGTGCTAGGCCTGCCATAGGTCGTTCACATATGATCAGTTTAGCTGAATGGGCAGTAGAGACGCAGAAGATGGGACAGTTGGAACAAATTGTAGATCCCACTATTGTGGCCAAAATAAGACCAGAGTCCCTCAGGATGTTTGGAGAAACGGCAGTGAAATGCTTAGCTTCATCTAGTGAAAATAGGCCATCAATGGGTGATGTGCTGTGGAAACTGGAGTATGCACTTCATCTCCAAGAGCCTATCATTCAAGATAATCCTGAATGA
ATGGGAACCAACTATTCCAAGCCAACAACTTCCATAAATGATGCTTCCAATTTGAGTAATCGCGTTCCTTTTGAAAGTTTTCGAGTTCCTTTTGTAGATTTGCAGGAAGCAACTAATAACTTTGATGACAAGTTTCTGATTGGAGTGGGTATATTTGGTAAGGTTTACAGGGGTGTTTTGCGTGATGGTACAAAGGTGGCCCTGAAAAGACGTAAGCCTGAGTCTCCACAAGGTATTGAAGAGTTCCGAACAGAAATTGAGATACTCTCACACTGCAGCCATCCACATCTGGTTTCACTGATAGGATACTGTGATGAAAGAAATGAGATGATTCTAATTTATGACTACATGGAGAATGGGAACCTCAGTAAACGTTTGTATGGATCAGATCTATGTCTTCCCACTATGAGCTGGGAGCAGAGGCTGGAGATATGCATCGGGGCAGCCAGAGGTCTTCACTACCTTCATAACAGTGCAGTTATACATCGTGATGTCAAGTCTACAAACATATTGCTTGATGAGAATTTTGTGGCAAAAATTACTGATTTTGGAATATCCAAGACAACGCCTGAGTTTGATCAAACCCATCTTAGCACAATGGTGCAAGGAAGTATAGGCTACATTGACCCTGAATATTTTATAAGGGGACAACTGACAAAAAAATCTGATGTTTATTCTTTCGGTGTTGTTTTATTCGAAGTTCTTTGTGCTAGGCCTGCCATAGGTCGTTCACATATGATCAGTTTAGCTGAATGGGCAGTAGAGACGCAGAAGATGGGACAGTTGGAACAAATTGTAGATCCCACTATTGTGGCCAAAATAAGACCAGAGTCCCTCAGGATGTTTGGAGAAACGGCAGTGAAATGCTTAGCTTCATCTAGTGAAAATAGGCCATCAATGGGTGATGTGCTGTGGAAACTGGAGTATGCACTTCATCTCCAAGAGCCTATCATTCAAGATAATCCTGAATGA
| Download sequence region |
Get flanking sequences on SL2.50ch05
|
mRNA Solyc05g013300.1.1
mRNA Solyc05g013300.1.1
|
Ontology terms
Ontology terms
| terms associated with this mRNA |
cDNA sequence
cDNA sequence
| spliced cDNA sequence, including UTRs |
>Solyc05g013300.1.1 Pto-like serine/threonine kinase (AHRD V1 **** Q6W0D3_CAPCH); contains Interpro domain(s) IPR017442 Serine/threonine protein kinase-related
ATGGGAACCAACTATTCCAAGCCAACAACTTCCATAAATGATGCTTCCAATTTGAGTAATCGCGTTCCTTTTGAAAGTTTTCGAGTTCCTTTTGTAGATTTGCAGGAAGCAACTAATAACTTTGATGACAAGTTTCTGATTGGAGTGGGTATATTTGGTAAGGTTTACAGGGGTGTTTTGCGTGATGGTACAAAGGTGGCCCTGAAAAGACGTAAGCCTGAGTCTCCACAAGGTATTGAAGAGTTCCGAACAGAAATTGAGATACTCTCACACTGCAGCCATCCACATCTGGTTTCACTGATAGGATACTGTGATGAAAGAAATGAGATGATTCTAATTTATGACTACATGGAGAATGGGAACCTCAGTAAACGTTTGTATGGATCAGATCTATGTCTTCCCACTATGAGCTGGGAGCAGAGGCTGGAGATATGCATCGGGGCAGCCAGAGGTCTTCACTACCTTCATAACAGTGCAGTTATACATCGTGATGTCAAGTCTACAAACATATTGCTTGATGAGAATTTTGTGGCAAAAATTACTGATTTTGGAATATCCAAGACAACGCCTGAGTTTGATCAAACCCATCTTAGCACAATGGTGCAAGGAAGTATAGGCTACATTGACCCTGAATATTTTATAAGGGGACAACTGACAAAAAAATCTGATGTTTATTCTTTCGGTGTTGTTTTATTCGAAGTTCTTTGTGCTAGGCCTGCCATAGGTCGTTCACATATGATCAGTTTAGCTGAATGGGCAGTAGAGACGCAGAAGATGGGACAGTTGGAACAAATTGTAGATCCCACTATTGTGGCCAAAATAAGACCAGAGTCCCTCAGGATGTTTGGAGAAACGGCAGTGAAATGCTTAGCTTCATCTAGTGAAAATAGGCCATCAATGGGTGATGTGCTGTGGAAACTGGAGTATGCACTTCATCTCCAAGAGCCTATCATTCAAGATAATCCTGAATGA
ATGGGAACCAACTATTCCAAGCCAACAACTTCCATAAATGATGCTTCCAATTTGAGTAATCGCGTTCCTTTTGAAAGTTTTCGAGTTCCTTTTGTAGATTTGCAGGAAGCAACTAATAACTTTGATGACAAGTTTCTGATTGGAGTGGGTATATTTGGTAAGGTTTACAGGGGTGTTTTGCGTGATGGTACAAAGGTGGCCCTGAAAAGACGTAAGCCTGAGTCTCCACAAGGTATTGAAGAGTTCCGAACAGAAATTGAGATACTCTCACACTGCAGCCATCCACATCTGGTTTCACTGATAGGATACTGTGATGAAAGAAATGAGATGATTCTAATTTATGACTACATGGAGAATGGGAACCTCAGTAAACGTTTGTATGGATCAGATCTATGTCTTCCCACTATGAGCTGGGAGCAGAGGCTGGAGATATGCATCGGGGCAGCCAGAGGTCTTCACTACCTTCATAACAGTGCAGTTATACATCGTGATGTCAAGTCTACAAACATATTGCTTGATGAGAATTTTGTGGCAAAAATTACTGATTTTGGAATATCCAAGACAACGCCTGAGTTTGATCAAACCCATCTTAGCACAATGGTGCAAGGAAGTATAGGCTACATTGACCCTGAATATTTTATAAGGGGACAACTGACAAAAAAATCTGATGTTTATTCTTTCGGTGTTGTTTTATTCGAAGTTCTTTGTGCTAGGCCTGCCATAGGTCGTTCACATATGATCAGTTTAGCTGAATGGGCAGTAGAGACGCAGAAGATGGGACAGTTGGAACAAATTGTAGATCCCACTATTGTGGCCAAAATAAGACCAGAGTCCCTCAGGATGTTTGGAGAAACGGCAGTGAAATGCTTAGCTTCATCTAGTGAAAATAGGCCATCAATGGGTGATGTGCTGTGGAAACTGGAGTATGCACTTCATCTCCAAGAGCCTATCATTCAAGATAATCCTGAATGA
Protein sequence
Protein sequence
| translated polypeptide sequence |
>Solyc05g013300.1.1 Pto-like serine/threonine kinase (AHRD V1 **** Q6W0D3_CAPCH); contains Interpro domain(s) IPR017442 Serine/threonine protein kinase-related
MGTNYSKPTTSINDASNLSNRVPFESFRVPFVDLQEATNNFDDKFLIGVGIFGKVYRGVLRDGTKVALKRRKPESPQGIEEFRTEIEILSHCSHPHLVSLIGYCDERNEMILIYDYMENGNLSKRLYGSDLCLPTMSWEQRLEICIGAARGLHYLHNSAVIHRDVKSTNILLDENFVAKITDFGISKTTPEFDQTHLSTMVQGSIGYIDPEYFIRGQLTKKSDVYSFGVVLFEVLCARPAIGRSHMISLAEWAVETQKMGQLEQIVDPTIVAKIRPESLRMFGETAVKCLASSSENRPSMGDVLWKLEYALHLQEPIIQDNPE*
MGTNYSKPTTSINDASNLSNRVPFESFRVPFVDLQEATNNFDDKFLIGVGIFGKVYRGVLRDGTKVALKRRKPESPQGIEEFRTEIEILSHCSHPHLVSLIGYCDERNEMILIYDYMENGNLSKRLYGSDLCLPTMSWEQRLEICIGAARGLHYLHNSAVIHRDVKSTNILLDENFVAKITDFGISKTTPEFDQTHLSTMVQGSIGYIDPEYFIRGQLTKKSDVYSFGVVLFEVLCARPAIGRSHMISLAEWAVETQKMGQLEQIVDPTIVAKIRPESLRMFGETAVKCLASSSENRPSMGDVLWKLEYALHLQEPIIQDNPE*
Gene model matches
Gene model matches
|
SGN Unigenes
SGN Unigenes
| [Associate new unigene] |
Unigene ID:
[loading...]
GenBank accessions
GenBank accessions
| [Associate new genbank sequence] |
LEU02271 protein kinase [Lycopersicon pimpinellifolium]
| Other genome matches | None |
Literature annotations [8]
Literature annotations [8]
| [Associate publication] [Matching publications] |
Map-based cloning of a protein kinase gene conferring disease resistance in tomato.
Science (New York, N.Y.) (1993)
Show / hide abstract
Show / hide abstract
The Pto gene in tomato confers resistance to races of Pseudomonas syringae pv. tomato that carry the avirulence gene avrPto. A yeast artificial chromosome clone that spans the Pto region was identified and used to probe a leaf complementary DNA (cDNA) library. A cDNA clone was isolated that represents a gene family, at least six members of which genetically cosegregate with Pto. When susceptible tomato plants were transformed with a cDNA from this family, they were resistant to the pathogen. Analysis of the amino acid sequence revealed similarity to serine-threonine protein kinases, suggesting a role for Pto in a signal transduction pathway.
Martin, GB. Brommonschenkel, SH. Chunwongse, J. Frary, A. Ganal, MW. Spivey, R. Wu, T. Earle, ED. Tanksley, SD.
Science (New York, N.Y.).
1993.
262(5138).
1432-6.
Two MAPK cascades, NPR1, and TGA transcription factors play a role in Pto-mediated disease resistance in tomato.
The Plant journal : for cell and molecular biology (2003)
Show / hide abstract
Show / hide abstract
The tomato Pto kinase confers resistance to the causative agent of bacterial speck disease, Pseudomonas syringae pv. tomato, by recognizing the pathogen effector proteins AvrPto or AvrPtoB. Pto-mediated resistance requires multiple signal transduction pathways and has been shown to activate many defense responses including an oxidative burst, rapid changes in the expression of over 400 genes, and localized cell death. We have tested the role in Pto-mediated resistance in tomato of a set of 21 genes from other species known to be involved in defense-related signaling. Expression of each gene was suppressed by virus-induced gene silencing (VIGS) and the effect on disease symptoms and bacterial growth during the tomato-Pseudomonas incompatible interaction was determined. We found that Pto-mediated resistance was compromised by silencing of genes encoding two mitogen-activated protein (MAP) kinase kinases, MEK1 and MEK2, two MAP kinases, NTF6 and wound-induced protein kinase (WIPK), a key regulator of systemic acquired resistance (SAR), NPR1, and two transcription factors, TGA1a and TGA2.2. A lesser impact on Pto-mediated resistance was observed in plants silenced for RAR1 and COI1. The identification of nine genes that play a role in resistance to bacterial speck disease both advances our knowledge of Pto signal transduction and demonstrates the conservation of many defense signaling components among diverse plant species.
Ekengren, SK. Liu, Y. Schiff, M. Dinesh, Kumar. Martin, GB.
The Plant journal : for cell and molecular biology.
2003.
36(6).
905-17.
A bacterial inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase.
Science (New York, N.Y.) (2006)
Show / hide abstract
Show / hide abstract
The Pseudomonas syringae protein AvrPtoB is translocated into plant cells, where it inhibits immunity-associated programmed cell death (PCD). The structure of a C-terminal domain of AvrPtoB that is essential for anti-PCD activity reveals an unexpected homology to the U-box and RING-finger components of eukaryotic E3 ubiquitin ligases, and we show that AvrPtoB has ubiquitin ligase activity. Mutation of conserved residues involved in the binding of E2 ubiquitin-conjugating enzymes abolishes this activity in vitro, as well as anti-PCD activity in tomato leaves, which dramatically decreases virulence. These results show that Pseudomonas syringae uses a mimic of host E3 ubiquitin ligases to inactivate plant defenses.
Janjusevic, R. Abramovitch, RB. Martin, GB. Stebbins, CE.
Science (New York, N.Y.).
2006.
311(5758).
222-6.
Type III effector AvrPtoB requires intrinsic E3 ubiquitin ligase activity to suppress plant cell death and immunity.
Proceedings of the National Academy of Sciences of the United States of America (2006)
Show / hide abstract
Show / hide abstract
Microbial pathogens of both plants and animals employ virulence factors that suppress the host immune response. The tomato pathogen Pseudomonas syringae injects the AvrPtoB type III effector protein into the plant cell to suppress programmed cell death (PCD) associated with plant immunity. AvrPtoB also inhibits PCD in yeast, indicating that AvrPtoB manipulates a conserved component of eukaryotic PCD. To identify host targets of AvrPtoB, we performed a yeast two-hybrid screen and identified tomato ubiquitin (Ub) as a strong AvrPtoB interactor. AvrPtoB is ubiquitinated in vitro and exhibits E3 Ub ligase activity in the presence of recombinant E1 activating enzyme and specific E2 Ub-conjugating enzymes. The C terminus of AvrPtoB is sufficient for both anti-PCD and E3 Ub ligase activities, suggesting the two functions are associated. Indeed, mutation of AvrPtoB lysine residues in the C terminus, between K512 and K529, disrupts AvrPtoB-Ub interactions, decreases AvrPtoB-mediated anti-PCD activity, and abrogates P. syringae pathogenesis of susceptible tomato plants. Remarkably, quantitative decreases in AvrPtoB anti-PCD activity are correlated with decreases in AvrPtoB ubiquitination and E3 Ub ligase activity. Overall, these data reveal a unique bacterial pathogenesis strategy, where AvrPtoB manipulates the host Ub system and requires intrinsic E3 Ub ligase activity to suppress plant immunity.
Abramovitch, RB. Janjusevic, R. Stebbins, CE. Martin, GB.
Proceedings of the National Academy of Sciences of the United States of America.
2006.
103(8).
2851-6.
Pto- and Prf-mediated recognition of AvrPto and AvrPtoB restricts the ability of diverse pseudomonas syringae pathovars to infect tomato.
Molecular plant-microbe interactions : MPMI (2007)
Show / hide abstract
Show / hide abstract
The molecular basis underlying the ability of pathogens to infect certain plant species and not others is largely unknown. Pseudomonas syringae is a useful model species for investigating this phenomenon because it comprises more than 50 pathovars which have narrow host range specificities. Tomato (Solanum lycopersicum) is a host for P. syringae pv. tomato, the causative agent of bacterial speck disease, but is considered a nonhost for other P. syringae pathovars. Host resistance in tomato to bacterial speck disease is conferred by the Pto protein kinase which acts in concert with the Prf nucleotide-binding lucine-rich repeat protein to recognize P. syringae pv. tomato strains expressing the type III effectors AvrPto or AvrPtoB (HopAB2). The Pto and Prf genes were isolated from the wild tomato species S. pimpinellifolium and functional alleles of both of these genes now are known to exist in many species of tomato and in other Solanaceous species. Here, we extend earlier reports that avrPto and avrPtoB genes are widely distributed among pathovars of P. syringae which are considered nonhost pathogens of tomato. This observation prompted us to examine the possibility that recognition of these type III effectors by Pto or Prf might contribute to the inability of many P. syringae pathovars to infect tomato species. We show that 10 strains from presumed nonhost P. syringae pathovars are able to grow and cause pathovar-unique disease symptoms in tomato leaves lacking Pto or Prf, although they did not reach the population levels or cause symptoms as severe as a control P. syringae pv. tomato strain. Seven of these strains were found to express avrPto or avrPtoB. The AvrPto- and AvrPtoB-expressing strains elicited disease resistance on tomato leaves expressing Pto and Prf. Thus, a gene-for-gene recognition event may contribute to host range restriction of many P. syringae pathovars on tomato species. Furthermore, we conclude that the diverse disease symptoms caused by different Pseudomonas pathogens on their normal plant hosts are due largely to the array of virulence factors expressed by each pathovar and not to specific molecular or morphological attributes of the plant host.
Lin, Nai. Martin, GB.
Molecular plant-microbe interactions : MPMI.
2007.
20(7).
806-15.
A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity.
Nature (2007)
Show / hide abstract
Show / hide abstract
Many bacterial pathogens of plants and animals use a type III secretion system to deliver diverse virulence-associated 'effector' proteins into the host cell. The mechanisms by which these effectors act are mostly unknown; however, they often promote disease by suppressing host immunity. One type III effector, AvrPtoB, expressed by the plant pathogen Pseudomonas syringae pv. tomato, has a carboxy-terminal domain that is an E3 ubiquitin ligase. Deletion of this domain allows an amino-terminal region of AvrPtoB (AvrPtoB(1-387)) to be detected by certain tomato varieties leading to immunity-associated programmed cell death. Here we show that a host kinase, Fen, physically interacts with AvrPtoB(1-387 )and is responsible for activating the plant immune response. The AvrPtoB E3 ligase specifically ubiquitinates Fen and promotes its degradation in a proteasome-dependent manner. This degradation leads to disease susceptibility in Fen-expressing tomato lines. Various wild species of tomato were found to exhibit immunity in response to AvrPtoB(1-387 )and not to full-length AvrPtoB. Thus, by acquiring an E3 ligase domain, AvrPtoB has thwarted a highly conserved host resistance mechanism.
Rosebrock, TR. Zeng, L. Brady, JJ. Abramovitch, RB. Xiao, F. Martin, GB.
Nature.
2007.
448(7151).
370-4.
The structural basis for activation of plant immunity by bacterial effector protein AvrPto.
Nature (2007)
Show / hide abstract
Show / hide abstract
Pathogenic microbes use effectors to enhance susceptibility in host plants. However, plants have evolved a sophisticated immune system to detect these effectors using cognate disease resistance proteins, a recognition that is highly specific, often elicits rapid and localized cell death, known as a hypersensitive response, and thus potentially limits pathogen growth. Despite numerous genetic and biochemical studies on the interactions between pathogen effector proteins and plant resistance proteins, the structural bases for such interactions remain elusive. The direct interaction between the tomato protein kinase Pto and the Pseudomonas syringae effector protein AvrPto is known to trigger disease resistance and programmed cell death through the nucleotide-binding site/leucine-rich repeat (NBS-LRR) class of disease resistance protein Prf. Here we present the crystal structure of an AvrPto-Pto complex. Contrary to the widely held hypothesis that AvrPto activates Pto kinase activity, our structural and biochemical analyses demonstrated that AvrPto is an inhibitor of Pto kinase in vitro. The AvrPto-Pto interaction is mediated by the phosphorylation-stabilized P+1 loop and a second loop in Pto, both of which negatively regulate the Prf-mediated defences in the absence of AvrPto in tomato plants. Together, our results show that AvrPto derepresses host defences by interacting with the two defence-inhibition loops of Pto.
Xing, W. Zou, Y. Liu, Q. Liu, J. Luo, X. Huang, Q. Chen, S. Zhu, L. Bi, R. Hao, Q. Wu, Jia. Zhou, Jian. Chai, J.
Nature.
2007.
449(7159).
243-7.
Crystal Structure of the Complex between Pseudomonas Effector AvrPtoB and the Tomato Pto Kinase Reveals Both a Shared and a Unique Interface Compared with AvrPto-Pto.
The Plant cell (2009)
Show / hide abstract
Show / hide abstract
Resistance to bacterial speck disease in tomato (Solanum lycopersicum) is activated upon recognition by the host Pto kinase of either one of two sequence-unrelated effector proteins, AvrPto or AvrPtoB, from Pseudomonas syringae pv tomato (Pst). Pto induces Pst immunity by acting in concert with the Prf protein. The recently reported structure of the AvrPto-Pto complex revealed that interaction of AvrPto with Pto appears to relieve an inhibitory effect of Pto, allowing Pto to activate Prf. Here, we present the crystal structure of the Pto binding domain of AvrPtoB (residues 121 to 205) at a resolution of 1.9A and of the AvrPtoB121-205-Pto complex at a resolution of 3.3 A. AvrPtoB121-205 exhibits a tertiary fold that is completely different from that of AvrPto, and its conformation remains largely unchanged upon binding to Pto. In common with AvrPto-Pto, the AvrPtoB-Pto complex relies on two interfaces. One of these interfaces is similar in both complexes, although the primary amino acid sequences from the two effector proteins are very different. Amino acid substitutions in Pto at the other interface disrupt the interaction of AvrPtoB-Pto but not that of AvrPto-Pto. Interestingly, substitutions in Pto affecting this unique interface also cause Pto to induce Prf-dependent host cell death independently of either effector protein.
Dong, J. Xiao, F. Fan, F. Gu, L. Cang, H. Martin, GB. Chai, J.
The Plant cell.
2009.
().
.
Ontology annotations (2)
Ontology annotations (2)
| [Add ontology annotations] |
[loading...]
Related views
Related views
|
- Genomic details
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Your Lists
Public Lists
List Contents
List Validation Report: Failed
Elements not found:
Optional: Add Missing Accessions to A List
Mismatched case
Click the Adjust Case button to align the case in the list with what is in the database.
Multiple mismatched case
Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.
List elements matching a synonym
Multiple synonym matches
Fuzzy Search Results
Synonym Search Results
Available Seedlots
List Comparison
Your Datasets
Public Datasets
Dataset Contents
Dataset Validation Failed
Elements not found:
Your Calendar
Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?
Add New Event
Event Info
| Attribute | Value |
|---|---|
| Project Name: | |
| Start Date: | |
| End Date: | |
| Event Type: | |
| Event Description: | |
| Event Web URL: |
Edit Event
Login
Forgot Username
If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.
Reset Password
To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.
Create New User
Working

Links to external databases
Links to external databases
