This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.
Tomato locus ethylene response factor E.1
| Locus details | Download GMOD XML | Note to Editors | Annotation guidelines |
[loading edit links...]
|
[loading...]
|
|
Links to external databases
Links to external databases
|
| Registry name: | None | [Associate registry name] |
Notes and figures (0)
Notes and figures (0)
| [Add notes, figures or images] |
Success
The display image was set successfully.
| Image | Description | Type |
|---|
Accessions and images (0)
Accessions and images (0)
| [Associate accession] |
Accession name:
Would you Like to specify an allele?
| Alleles (0) | None | [Add new Allele] |
Associated loci (22)
Associated loci (22)
| [Associate new locus] |
[loading...]
|
Associated loci - graphical view
Associated loci - graphical view
| View ethylene response factor E.1 relationships in the stand-alone network browser |
[loading...] | [Legend] [Levels] |
SolCyc links
SolCyc links
|
[loading...]
Sequence annotations
Sequence annotations
|
Genome features
Genome features
|
Genomic sequence
Genomic sequence
| unprocessed genomic sequence region underlying this gene |
>Solyc09g075420.2 SL2.50ch09:67127407..67128628
TCCACCACTACAAATACCTCCCCATTTCTCCCCACACCAAAACCAAAACTGAAACTAAAACAAAACTTTTCTATACATTTTTCATTTCTGTATCAATCAATATTCTTTGTTTCTGCTGTTTTGAGTAAATCACACTAAGATGTGTGGTGGTGCAATTCTTGCTGATATCATTCCTCCTCGTGACCGCCGTTTGTCATCCACCGACCTATGGCCGACTGATTTCTGGCCAATTTCCACCCAAAATGTTCCTCTCAACCCCAAACGAGCTCGACCCTCTACAGGTACTAGTTAATCATATATAAAGCTTAATTTGTTGATTTTGTTTTTATGCTCATTTAGGCATTTCAACAAACAGGTGGTGAGCAGATGAAGAAGAGGCAAAGGAAGAATCTTTACAGAGGGATAAGACAACGTCCATGGGGTAAATGGGCTGCTGAAATTCGTGACCCGAGAAAAGGGGTTAGGGTTTGGTTAGGTACTTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATAGAGAAGCTCGTAAAATCAGGGGTAAGAAAGCTAAAGTTAATTTCCCCAATGAAGATGACGACCATTACTGCTACAGTCATCCAGAGCCCCCTCCCTTGAACATTGCTTGTGATACTACTGTTACTTACAATCAAGAATCAAATAACTGTTACCCCTTTTACTCAATCGAGAACGTTGAACCTGTTATGGAATTTGCAAGTTATAATGGAATTGAAGATGGAGGAGAGGAGATGGTGAAAAATTTGAATAACAGGGTTGTAGAGGAAGAGGAGAAAACAGAGGATGAAGTGCAGATACTTTCTGATGAGCTGATGGCTTATGAGTCATTGATGAAGTTCTATGAAATACCGTATGTTGACGGGCAATCAGTGGCGGCGACGGTGAATCCAGCGGCGGAGACCGCCGTGGGCGGTGGCTCGATGGAGCTTTGGAGTTTTGATGATGTTAGTCGTCTACAACCAAGTTATAATGTAGTTTAATTATTGTTTTGTTTAAACTTTTCATAATTTTATTTTATCGAATTAGGAAGAATTGAGTTTTTATAATTTAATCAATTGTGTAAAACTATGTTTCTAATTCATTAATATTATATTGGATATGTTGTTATTAAAAAATATTTTTTTTTAATTATTTTGTTAGAACTATATTTTATTACATAAGATTCAAATTTGAGAGCCCTTATTAATAAAATAAAGTTTTAGTTTA
TCCACCACTACAAATACCTCCCCATTTCTCCCCACACCAAAACCAAAACTGAAACTAAAACAAAACTTTTCTATACATTTTTCATTTCTGTATCAATCAATATTCTTTGTTTCTGCTGTTTTGAGTAAATCACACTAAGATGTGTGGTGGTGCAATTCTTGCTGATATCATTCCTCCTCGTGACCGCCGTTTGTCATCCACCGACCTATGGCCGACTGATTTCTGGCCAATTTCCACCCAAAATGTTCCTCTCAACCCCAAACGAGCTCGACCCTCTACAGGTACTAGTTAATCATATATAAAGCTTAATTTGTTGATTTTGTTTTTATGCTCATTTAGGCATTTCAACAAACAGGTGGTGAGCAGATGAAGAAGAGGCAAAGGAAGAATCTTTACAGAGGGATAAGACAACGTCCATGGGGTAAATGGGCTGCTGAAATTCGTGACCCGAGAAAAGGGGTTAGGGTTTGGTTAGGTACTTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATAGAGAAGCTCGTAAAATCAGGGGTAAGAAAGCTAAAGTTAATTTCCCCAATGAAGATGACGACCATTACTGCTACAGTCATCCAGAGCCCCCTCCCTTGAACATTGCTTGTGATACTACTGTTACTTACAATCAAGAATCAAATAACTGTTACCCCTTTTACTCAATCGAGAACGTTGAACCTGTTATGGAATTTGCAAGTTATAATGGAATTGAAGATGGAGGAGAGGAGATGGTGAAAAATTTGAATAACAGGGTTGTAGAGGAAGAGGAGAAAACAGAGGATGAAGTGCAGATACTTTCTGATGAGCTGATGGCTTATGAGTCATTGATGAAGTTCTATGAAATACCGTATGTTGACGGGCAATCAGTGGCGGCGACGGTGAATCCAGCGGCGGAGACCGCCGTGGGCGGTGGCTCGATGGAGCTTTGGAGTTTTGATGATGTTAGTCGTCTACAACCAAGTTATAATGTAGTTTAATTATTGTTTTGTTTAAACTTTTCATAATTTTATTTTATCGAATTAGGAAGAATTGAGTTTTTATAATTTAATCAATTGTGTAAAACTATGTTTCTAATTCATTAATATTATATTGGATATGTTGTTATTAAAAAATATTTTTTTTTAATTATTTTGTTAGAACTATATTTTATTACATAAGATTCAAATTTGAGAGCCCTTATTAATAAAATAAAGTTTTAGTTTA
| Download sequence region |
Get flanking sequences on SL2.50ch09
|
mRNA Solyc09g075420.2.1
mRNA Solyc09g075420.2.1
|
Ontology terms
Ontology terms
| terms associated with this mRNA |
cDNA sequence
cDNA sequence
| spliced cDNA sequence, including UTRs |
>Solyc09g075420.2.1 Ethylene responsive transcription factor 2b (AHRD V1 *-*- C0J9I6_9ROSA); contains Interpro domain(s) IPR001471 Pathogenesis-related transcriptional factor and ERF, DNA-binding IPR001711 Phospholipase C, phosphatidylinositol-specific, Y domain
TCCACCACTACAAATACCTCCCCATTTCTCCCCACACCAAAACCAAAACTGAAACTAAAACAAAACTTTTCTATACATTTTTCATTTCTGTATCAATCAATATTCTTTGTTTCTGCTGTTTTGAGTAAATCACACTAAGATGTGTGGTGGTGCAATTCTTGCTGATATCATTCCTCCTCGTGACCGCCGTTTGTCATCCACCGACCTATGGCCGACTGATTTCTGGCCAATTTCCACCCAAAATGTTCCTCTCAACCCCAAACGAGCTCGACCCTCTACAGGTGGTGAGCAGATGAAGAAGAGGCAAAGGAAGAATCTTTACAGAGGGATAAGACAACGTCCATGGGGTAAATGGGCTGCTGAAATTCGTGACCCGAGAAAAGGGGTTAGGGTTTGGTTAGGTACTTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATAGAGAAGCTCGTAAAATCAGGGGTAAGAAAGCTAAAGTTAATTTCCCCAATGAAGATGACGACCATTACTGCTACAGTCATCCAGAGCCCCCTCCCTTGAACATTGCTTGTGATACTACTGTTACTTACAATCAAGAATCAAATAACTGTTACCCCTTTTACTCAATCGAGAACGTTGAACCTGTTATGGAATTTGCAAGTTATAATGGAATTGAAGATGGAGGAGAGGAGATGGTGAAAAATTTGAATAACAGGGTTGTAGAGGAAGAGGAGAAAACAGAGGATGAAGTGCAGATACTTTCTGATGAGCTGATGGCTTATGAGTCATTGATGAAGTTCTATGAAATACCGTATGTTGACGGGCAATCAGTGGCGGCGACGGTGAATCCAGCGGCGGAGACCGCCGTGGGCGGTGGCTCGATGGAGCTTTGGAGTTTTGATGATGTTAGTCGTCTACAACCAAGTTATAATGTAGTTTAATTATTGTTTTGTTTAAACTTTTCATAATTTTATTTTATCGAATTAGGAAGAATTGAGTTTTTATAATTTAATCAATTGTGTAAAACTATGTTTCTAATTCATTAATATTATATTGGATATGTTGTTATTAAAAAATATTTTTTTTTAATTATTTTGTTAGAACTATATTTTATTACATAAGATTCAAATTTGAGAGCCCTTATTAATAAAATAAAGTTTTAGTTTA
TCCACCACTACAAATACCTCCCCATTTCTCCCCACACCAAAACCAAAACTGAAACTAAAACAAAACTTTTCTATACATTTTTCATTTCTGTATCAATCAATATTCTTTGTTTCTGCTGTTTTGAGTAAATCACACTAAGATGTGTGGTGGTGCAATTCTTGCTGATATCATTCCTCCTCGTGACCGCCGTTTGTCATCCACCGACCTATGGCCGACTGATTTCTGGCCAATTTCCACCCAAAATGTTCCTCTCAACCCCAAACGAGCTCGACCCTCTACAGGTGGTGAGCAGATGAAGAAGAGGCAAAGGAAGAATCTTTACAGAGGGATAAGACAACGTCCATGGGGTAAATGGGCTGCTGAAATTCGTGACCCGAGAAAAGGGGTTAGGGTTTGGTTAGGTACTTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATAGAGAAGCTCGTAAAATCAGGGGTAAGAAAGCTAAAGTTAATTTCCCCAATGAAGATGACGACCATTACTGCTACAGTCATCCAGAGCCCCCTCCCTTGAACATTGCTTGTGATACTACTGTTACTTACAATCAAGAATCAAATAACTGTTACCCCTTTTACTCAATCGAGAACGTTGAACCTGTTATGGAATTTGCAAGTTATAATGGAATTGAAGATGGAGGAGAGGAGATGGTGAAAAATTTGAATAACAGGGTTGTAGAGGAAGAGGAGAAAACAGAGGATGAAGTGCAGATACTTTCTGATGAGCTGATGGCTTATGAGTCATTGATGAAGTTCTATGAAATACCGTATGTTGACGGGCAATCAGTGGCGGCGACGGTGAATCCAGCGGCGGAGACCGCCGTGGGCGGTGGCTCGATGGAGCTTTGGAGTTTTGATGATGTTAGTCGTCTACAACCAAGTTATAATGTAGTTTAATTATTGTTTTGTTTAAACTTTTCATAATTTTATTTTATCGAATTAGGAAGAATTGAGTTTTTATAATTTAATCAATTGTGTAAAACTATGTTTCTAATTCATTAATATTATATTGGATATGTTGTTATTAAAAAATATTTTTTTTTAATTATTTTGTTAGAACTATATTTTATTACATAAGATTCAAATTTGAGAGCCCTTATTAATAAAATAAAGTTTTAGTTTA
Protein sequence
Protein sequence
| translated polypeptide sequence |
>Solyc09g075420.2.1 Ethylene responsive transcription factor 2b (AHRD V1 *-*- C0J9I6_9ROSA); contains Interpro domain(s) IPR001471 Pathogenesis-related transcriptional factor and ERF, DNA-binding IPR001711 Phospholipase C, phosphatidylinositol-specific, Y domain
MCGGAILADIIPPRDRRLSSTDLWPTDFWPISTQNVPLNPKRARPSTGGEQMKKRQRKNLYRGIRQRPWGKWAAEIRDPRKGVRVWLGTFNTAEEAARAYDREARKIRGKKAKVNFPNEDDDHYCYSHPEPPPLNIACDTTVTYNQESNNCYPFYSIENVEPVMEFASYNGIEDGGEEMVKNLNNRVVEEEEKTEDEVQILSDELMAYESLMKFYEIPYVDGQSVAATVNPAAETAVGGGSMELWSFDDVSRLQPSYNVV*
MCGGAILADIIPPRDRRLSSTDLWPTDFWPISTQNVPLNPKRARPSTGGEQMKKRQRKNLYRGIRQRPWGKWAAEIRDPRKGVRVWLGTFNTAEEAARAYDREARKIRGKKAKVNFPNEDDDHYCYSHPEPPPLNIACDTTVTYNQESNNCYPFYSIENVEPVMEFASYNGIEDGGEEMVKNLNNRVVEEEEKTEDEVQILSDELMAYESLMKFYEIPYVDGQSVAATVNPAAETAVGGGSMELWSFDDVSRLQPSYNVV*
Gene model matches
Gene model matches
|
SGN Unigenes
SGN Unigenes
| [Associate new unigene] |
Unigene ID:
[loading...]
GenBank accessions
GenBank accessions
| [Associate new genbank sequence] |
| Other genome matches | None |
Literature annotations [5]
Literature annotations [5]
| [Associate publication] [Matching publications] |
New members of the tomato ERF family show specific expression pattern and diverse DNA-binding capacity to the GCC box element.
FEBS letters (2003)
Show / hide abstract
Show / hide abstract
Four new members of the ERF (ethylene-response factor) family of plant-specific DNA-binding (GCC box) factors were isolated from tomato fruit (LeERF1-4). Phylogenetic analysis indicated that LeERF2 belongs to a new ERF class, characterized by a conserved N-terminal signature sequence. Expression patterns and cis/trans binding affinities differed between the LeERFs. Combining experimental data and modeled three-dimensional analysis, it was shown that binding affinity of the LeERFs was affected by both the variation of nucleotides surrounding the DNA cis-element sequence and the nature of critical amino acid residues within the ERF domain.
Tournier, B. Sanchez, Ballesta. Jones, B. Pesquet, E. Regad, F. Latché, A. Pech, Jean. Bouzayen, M.
FEBS letters.
2003.
550(1-3).
149-54.
Cloning and DNA-binding properties of ethylene response factor, LeERF1 and LeERF2, in tomato.
Biotechnology letters (2005)
Show / hide abstract
Show / hide abstract
Two new genes, LeERF1 andLeERF2, were isolated from a tomato (Lycopersicon esculentum cv. Lichun) cDNA library. Phylogenetic analysis indicated that they encoded Ethylene Responsive Element Binding Proteins (EREBPs), characterized by a conserved ERF (ethylene response factor) domain of specific binding plant cis-acting elements GCC box. Both LeERF1 and LeERF2 proteins were obtained via prokaryotic expression and purification. Electrophoretic mobility shift assay showed that LeERF1 and LeERF2 protein could bind to the promoter of the NP24 gene coding for pathogenesis-related protein osmotin precursor but not the mutant promoter where its GCC box was deleted. Polyclonal antibodies of LeERF1 and LeERF2 blocked their binding in vitro.
Hongxing, Z. Benzhong, Z. Bianyun, Y. Yanling, H. Daqi, F. Wentao, X. Yunbo, L.
Biotechnology letters.
2005.
27(6).
423-8.
Sl-ERF2, a tomato ethylene response factor involved in ethylene response and seed germination.
Plant & cell physiology (2006)
Show / hide abstract
Show / hide abstract
Ethylene response factors (ERFs) are plant transcriptional regulators mediating ethylene-dependent gene expression via binding to the GCC motif found in the promoter region of ethylene-regulated genes. We report here on the structural and functional characterization of the tomato Sl-ERF2 gene that belongs to a distinct class of the large ERF gene family. Both spliced and unspliced versions of Sl-ERF2 transcripts were amplified from RNA samples and the search in the public tomato expressed sequence tag (EST) database confirmed the existence of the two transcript species in a number of cDNA libraries. The unspliced transcript contains two open reading frames yielding two hypothetical proteins, a small highly truncated version lacking the APETALA2 domain and a bigger protein lacking the N-terminal MCGGAAI(I)/(L) consensus peptide specific to ERF members from subfamily IV. Nevertheless, functional Sl-ERF2 protein may only derive from spliced transcripts since, depending on the tissue, the level of the spliced transcript is much higher than that of the unspliced transcript. Sl-ERF2 is expressed in all plant tissues tested, though its transcript accumulates preferentially in germinating seeds and ripening fruit. Overexpression of the Sl-ERF2 gene in transgenic tomato lines results in premature seed germination and enhanced hook formation of dark-grown seedlings, which is indicative of increased ethylene sensitivity. The expression of the mannanase2 gene is upregulated in Sl-ERF2-overexpressing seeds, suggesting that Sl-ERF2 stimulates seed germination through the induction of the mannanase2 gene. It is noteworthy that the exaggerated hook phenotype is abolished when ethylene perception is blocked, strongly suggesting that Sl-ERF2 requires other ethylene-dependent components to impact the hook formation process.
Pirrello, J. Jaimes, Miranda. Sanchez, Ballesta. Tournier, B. Khalil, Ahmad. Regad, F. Latché, A. Pech, JC. Bouzayen, M.
Plant & cell physiology.
2006.
47(9).
1195-205.
LeERF1 positively modulated ethylene triple response on etiolated seedling, plant development and fruit ripening and softening in tomato.
Plant cell reports (2008)
Show / hide abstract
Show / hide abstract
To study the function of LeERF1 in ethylene triple response on etiolated seedling, plant development and fruit ripening and softening, LeERF1 gene was introduced into tomato (Lycopersicon esculentum cv. No. 4 Zhongshu) through Agrobacterium-mediated transformation. The sense LeERF1 and anti-sense LeERF1 transgenic tomato were obtained. Overexpression of LeERF1 in tomato caused the typical ethylene triple response on etiolated seedling. In the adult stage, 35S::LeERF1 resulted in morphological changes in the leaves of the LeERF1-sn lines. Anti-sense LeERF1 fruits had longer shelf life compared with wild-type tomato. The results of this manuscript indicated that LeERF1 positively mediated the ethylene signals, while the function of LeERF1 was verified for the first time to be positively related with ethylene triple response on etiolated seedling, plant development and fruit ripening and softening using LeERF1-sn, wt and LeERF1-as tomato.
Li, Y. Zhu, B. Xu, W. Zhu, H. Chen, A. Xie, Y. Shao, Y. Luo, Y.
Plant cell reports.
2008.
26(11).
1999-2008.
Functional analysis and binding affinity of tomato ethylene response factors provide insight on the molecular bases of plant differential responses to ethylene.
BMC plant biology (2013)
Show / hide abstract
Show / hide abstract
The data reveal that regions flanking the core GCC-box sequence are part of the discrimination mechanism by which ERFs selectively bind to their target promoters. ERF tissue-specific expression combined to their responsiveness to both ethylene and auxin bring some insight on the complexity and fine regulation mechanisms involving these transcriptional mediators. All together the data support the hypothesis that ERFs are the main component enabling ethylene to regulate a wide range of physiological processes in a highly specific and coordinated manner.
Pirrello, J. Prasad, BC. Zhang, W. Chen, K. Mila, I. Zouine, M. Latché, A. Pech, JC. Ohme-Takagi, M. Regad, F. Bouzayen, M.
BMC plant biology.
2013.
12().
190.
Ontology annotations (11)
Ontology annotations (11)
| [Add ontology annotations] |
[loading...]
Related views
Related views
|
- Genomic details
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Your Lists
Public Lists
List Contents
List Validation Report: Failed
Elements not found:
Optional: Add Missing Accessions to A List
Mismatched case
Click the Adjust Case button to align the case in the list with what is in the database.
Multiple mismatched case
Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.
List elements matching a synonym
Multiple synonym matches
Fuzzy Search Results
Synonym Search Results
Available Seedlots
Your Datasets
Public Datasets
Dataset Contents
Dataset Validation Failed
Elements not found:
Your Calendar
Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?
Add New Event
Event Info
| Attribute | Value |
|---|---|
| Project Name: | |
| Start Date: | |
| End Date: | |
| Event Type: | |
| Event Description: | |
| Event Web URL: |
Edit Event
Login
Forgot Username
If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.
Reset Password
To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.
Create New User
Working

Links to external databases
Links to external databases
