This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.
Tomato locus Immunity to Fusarium wilt race 2
| Locus details | Download GMOD XML | Note to Editors | Annotation guidelines |
[loading edit links...]
|
[loading...]
|
|
Links to external databases
Links to external databases
|
Immunity to Fusarium wilt race 2 is a TGRC gene
TomDelDB genotype frequencies in tomato populations. chromosome SL2.50ch11, position: 54910730
Please cite Razifard et al.
TomDelDB genotype frequencies in tomato populations. chromosome SL2.50ch11, position: 54911832
Please cite Razifard et al.
TomDelDB genotype frequencies in tomato populations. chromosome SL2.50ch11, position: 54913079
Please cite Razifard et al.
| Registry name: | None | [Associate registry name] |
Notes and figures (0)
Notes and figures (0)
| [Add notes, figures or images] |
Success
The display image was set successfully.
| Image | Description | Type |
|---|
Accessions and images (11)
Accessions and images (11)
| [Associate accession] |
Alleles (1)
Alleles (1)
| [Add new Allele] |
Associated loci (0)
Associated loci (0)
| [Associate new locus] |
[loading...]
|
| Associated loci - graphical view | None |
SolCyc links
SolCyc links
|
[loading...]
Sequence annotations
Sequence annotations
|
Genome features
Genome features
|
Genomic sequence
Genomic sequence
| unprocessed genomic sequence region underlying this gene |
>Solyc11g071430.1 SL2.50ch11:54910177..54913966
ATGTTTCGGAAGCACAAGGATCATGTTAAGCTCTTAAAGAAGCTGAAAATGACTTTGTGTGGTCTTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAATCCATCTGTGAGCGACTGGCTTAATGAGCTTCGAGATGCTGTTGACTCTGCTGAAAATTTAATAGAAGAAGTCAATTATGAAGCTTTGAGGCTTAAGGTGGAAGGCCAGCATCAAAATCTTGCTGAAACAAGCAACAAACAAGTAAGTGACCTCAACTTGTGCTTGAGTGATGATTTCTTTCGTAACATAAAGGATAAGTTGGAAGAAACTATTGAAACGTTGGAGGTGTTGGAAAAGCAAATTGGTCGCCTTGGCTTAAAGGAGTATTTTATTTCGACCAAACAAGAAACTAGAACACCTTCAACTTCTTTGGTTGTTGATTCTGGTATCTTTGGAAGGCAGAATGAAATAGAGGATTTGGTTGGCCGTTTGTTGTCTATGGATACAAAGGGAAAAAATTTAGCTGTAGTTCCTATTGTTGGAATGGGCGGCCTGGGTAAGACAACACTTGCTAAGGCGGTTTACAATGATGAGAGAGTGAAGAAACATTTTGGTTTGACAGCTTGGTTTTGTGTTTCTGAGGTATGATGCTTTCAGAATAACAAAAGGTATACTTCAAGAAATTGGCTCAACAGACTTGAAGGCTGATCACAATCTTAATCAGCTTCAAGTCAAAGTGAAGGAAAGTTTGAAGGGAAAGAAGTTTCTTATTGTTTTGGATGATGTGTGGAATGACAACTACAACGAGTGGGATGACTTGAGAAACATTTTTGTACAAGGAGATATAGGAAGTAAGATCATTGTGACGACACGCAAAAACAGTGTTGCCTTGATGATGGGAAATGAGCAAATTAGCATGAACAATTTGTCTACTGAAGCCTCTTGGTCTTTGTTTAAAAGACATGCATTTGAAAACATGAATCCTATGGGATATCCGGAACTCGAAGAGGTCGGAAAACAAATTGCAGCTAAGTGTAAAGGACTGCCCTTAGCTCTGAAGACACTCGCTGGCATGTTATGCTCCAAATCAGAGATTGATGAGTGGAAACGTATTTTGAGAAGTGAAATATGGGAGCTGCGAGACAATGACATATTACCAGCGTTGATGTTGAGCTACAATGATCTTCCCGCACATTTAAAGCGATGCTTTTGTTTTTGTGCAATATTTCCTAAAGATTATCCATTTAGGAAAGAACAAGTTATTCATCTATGGATTGCCAATGGTCTCGTACCAGTGAAAGATGAAATAAATCAAGATTTAGGCAACCAATTCTTTCTCGAGTTGAGTTCAAGATCATTATTTGAAAGGGTCCCAAATCCTTCTGAAGGAAACATAAAGGAATTATTCCTAATGCATGACCTTGTCAATGATTTAGCCCAACTTGCATCTTCAAAACTTTGTATCAGGTTGGAAGAGAGCCAAGGATCTCATATGTTGGAAAAAAGTCGGCATTTATCATATTCTATGGTCAATGATGGTGAGTTTGAGAAATTGACACCCCTCTGCAAATTGGAGGGGCTGAGGACTTTGCTTCCGATATGTATTAGTGTCAATTATTGTTATCACCCTCTAAGCAAGAGGGTGTTGCATAACATACTGCCTACACTAAGATTCTTGAGGGTACTATCATTCTCTCATTACAAGATTGAGGAGTTGCCAAATGACTTGTTTATCAAATTAAAGCTCCTCAGATTTTTGGACCTTTCTGAGACATGGATTAAAAAGTTGCCAGATTCCATATGTGGATTGTATAACTTAGAGACACTTCTCCTGTCATCTTGTTGTTCTCTTAAGGAGCTACCGCTGCATATGGAGAAGTTGATTAACTTGCGTCATCTTGACATAAGCAACACTTGGCGCTTGAAGATGCCACTACATCTGAGCAGGTTGAAAAGCCTCCAAGTGTTAGTGGGAGCCAAGTTTCTTCTAGGTGTTTGGAGAACGGAAGATTTGGGTGAAGCAAAAAACTTATATGGATCTCTATCAATTCTAGAGTTGGAAAATGTGGTTGATAGAAGGGAAGCTGTGAAGGCAAAGATGAGGGAGAAGAATCATGTTGACAAGTTATCTTTGAAGTGGAGTGAAAGTATTAGTGCTGACAATTCACATACAGAAAGAGACATACTTGATGAGCTATGCCCACATAAAAACATAAAAGAAGTCAAAATCATTGGATATAGAGGGACAAACTTTCCCGATTGGGTTGCTGATCCTTTGTTTCTTAAACTGGTGAAATTGTCTCTTAGAAACTGCAAGAACTGTTATTCCTTGCCAGCACTAGGACAACTCCCTTGTTTGAAATTCCTTTCCGTTAAAGGGATGCATGGAATAAGAGTGGTGACGGAAGAATTCTATGGCAGATTGTCGTCCAAAAAGCCTTTTAACTGTCTTGAGAAGCTTGAATTTGAAGATATGACGGAGTGGAAGCAATGGCACGCACTAGGAATTGGAGAGTTCCCTACACTTGAGAACCTTTCAATTAAAAATTGCCCTGAGCTCAGTTTGGAGATACCCATCCAATTTTCTAGTTTAAAAAGGTTAGAAGTTGTTGGTTGTCCAGTTGTTATTGATGATGCTCAACTGTTTAGATCCCAACTTAAAGCAATGAAGCAGATTGAGGAAATATATATATGGGATTGTAAGTCTGTTACCTCCTTTCCTTTTAGCATACTGCCAACTACCTTGAAGAGAATACAGATATCTCATTGCCCGAAATTGAGATTGGAGGCGCCAGTTTGTGAGATGTTTGTGGAGTATTTGAGTGTGAAGGATTGTGGTTGTGTAGATGATATATCACCTGAGTTTCTCCCAACAGCACGTGAATTGAGTATTGAAAATTGCCAGAACGTTACTAGGTTTTTGATTCCTACTGCCACTGAAACTCTCCATATTCGGAATTGTGAGAATGTTGAAAAACTATCGGTGGCATGTGGAGGAGCGGCCCAGATGACGTTACTGGATATCTATGGCTGTAAGAAGCTCAAGTGTCTTCCAGAACTCCTTCCATCTCTCAAGGAACTGCAACTGTCTGATTGTCCAGAAATAGAAGGAGAATTGCCCTTCAATTTACAAGAACTCTATATCAGTAATTGCAAGAAACTGGTGAATGGCCGAAAGCAGTGGCATTTACAGAGACTCACAGAGTTATGGATCATTCATGATGGGAGTGACGAAGATATTGAACATTGGGAGTTGCCTTCCTCTATTCAGAGTCTTACCATATGCAATCTGATAACATTAAGCAGCCAACATCTCAAAAGCCTCACCTCTCTTCAATATCTAGATATTGAGGGTAATTTATCTCGGATTCAGTCACAAGGCCAGCTTTCCTCCTTTTCTCACCTCACTTCGCTTCAAGCTCTACAAATCCGTAATCTCCAATCACTTGCTGAATCAGCACAGCCCTCCTCCCTCTCTCACCTGACCATCTCCGATTGCCCTAATCTCCAATCACTTGCTGAATCAGCGCTGCCCTCCTCCCTCTCTCACCTGGGCATCTCCGATTGCTCTAATCTCCAATCACTTGCTGAATCAGCACTGCCATCCTCCCTCTCTCACCTGAACATCTCCGATTGCCCTAATCTCCAATCCCTTCCATCAAAAGGGATGCCCTCTTCCCTCTCTGAACTATCGATTTCCGAATGTCCATTGCTCAAACCACTACTAGAATTTGAAAAGGGGGAGTACTGGCCACAAATTGCTCATATCCCCACCATAGAGATCGATGGGGAATGCATGTAA
ATGTTTCGGAAGCACAAGGATCATGTTAAGCTCTTAAAGAAGCTGAAAATGACTTTGTGTGGTCTTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAATCCATCTGTGAGCGACTGGCTTAATGAGCTTCGAGATGCTGTTGACTCTGCTGAAAATTTAATAGAAGAAGTCAATTATGAAGCTTTGAGGCTTAAGGTGGAAGGCCAGCATCAAAATCTTGCTGAAACAAGCAACAAACAAGTAAGTGACCTCAACTTGTGCTTGAGTGATGATTTCTTTCGTAACATAAAGGATAAGTTGGAAGAAACTATTGAAACGTTGGAGGTGTTGGAAAAGCAAATTGGTCGCCTTGGCTTAAAGGAGTATTTTATTTCGACCAAACAAGAAACTAGAACACCTTCAACTTCTTTGGTTGTTGATTCTGGTATCTTTGGAAGGCAGAATGAAATAGAGGATTTGGTTGGCCGTTTGTTGTCTATGGATACAAAGGGAAAAAATTTAGCTGTAGTTCCTATTGTTGGAATGGGCGGCCTGGGTAAGACAACACTTGCTAAGGCGGTTTACAATGATGAGAGAGTGAAGAAACATTTTGGTTTGACAGCTTGGTTTTGTGTTTCTGAGGTATGATGCTTTCAGAATAACAAAAGGTATACTTCAAGAAATTGGCTCAACAGACTTGAAGGCTGATCACAATCTTAATCAGCTTCAAGTCAAAGTGAAGGAAAGTTTGAAGGGAAAGAAGTTTCTTATTGTTTTGGATGATGTGTGGAATGACAACTACAACGAGTGGGATGACTTGAGAAACATTTTTGTACAAGGAGATATAGGAAGTAAGATCATTGTGACGACACGCAAAAACAGTGTTGCCTTGATGATGGGAAATGAGCAAATTAGCATGAACAATTTGTCTACTGAAGCCTCTTGGTCTTTGTTTAAAAGACATGCATTTGAAAACATGAATCCTATGGGATATCCGGAACTCGAAGAGGTCGGAAAACAAATTGCAGCTAAGTGTAAAGGACTGCCCTTAGCTCTGAAGACACTCGCTGGCATGTTATGCTCCAAATCAGAGATTGATGAGTGGAAACGTATTTTGAGAAGTGAAATATGGGAGCTGCGAGACAATGACATATTACCAGCGTTGATGTTGAGCTACAATGATCTTCCCGCACATTTAAAGCGATGCTTTTGTTTTTGTGCAATATTTCCTAAAGATTATCCATTTAGGAAAGAACAAGTTATTCATCTATGGATTGCCAATGGTCTCGTACCAGTGAAAGATGAAATAAATCAAGATTTAGGCAACCAATTCTTTCTCGAGTTGAGTTCAAGATCATTATTTGAAAGGGTCCCAAATCCTTCTGAAGGAAACATAAAGGAATTATTCCTAATGCATGACCTTGTCAATGATTTAGCCCAACTTGCATCTTCAAAACTTTGTATCAGGTTGGAAGAGAGCCAAGGATCTCATATGTTGGAAAAAAGTCGGCATTTATCATATTCTATGGTCAATGATGGTGAGTTTGAGAAATTGACACCCCTCTGCAAATTGGAGGGGCTGAGGACTTTGCTTCCGATATGTATTAGTGTCAATTATTGTTATCACCCTCTAAGCAAGAGGGTGTTGCATAACATACTGCCTACACTAAGATTCTTGAGGGTACTATCATTCTCTCATTACAAGATTGAGGAGTTGCCAAATGACTTGTTTATCAAATTAAAGCTCCTCAGATTTTTGGACCTTTCTGAGACATGGATTAAAAAGTTGCCAGATTCCATATGTGGATTGTATAACTTAGAGACACTTCTCCTGTCATCTTGTTGTTCTCTTAAGGAGCTACCGCTGCATATGGAGAAGTTGATTAACTTGCGTCATCTTGACATAAGCAACACTTGGCGCTTGAAGATGCCACTACATCTGAGCAGGTTGAAAAGCCTCCAAGTGTTAGTGGGAGCCAAGTTTCTTCTAGGTGTTTGGAGAACGGAAGATTTGGGTGAAGCAAAAAACTTATATGGATCTCTATCAATTCTAGAGTTGGAAAATGTGGTTGATAGAAGGGAAGCTGTGAAGGCAAAGATGAGGGAGAAGAATCATGTTGACAAGTTATCTTTGAAGTGGAGTGAAAGTATTAGTGCTGACAATTCACATACAGAAAGAGACATACTTGATGAGCTATGCCCACATAAAAACATAAAAGAAGTCAAAATCATTGGATATAGAGGGACAAACTTTCCCGATTGGGTTGCTGATCCTTTGTTTCTTAAACTGGTGAAATTGTCTCTTAGAAACTGCAAGAACTGTTATTCCTTGCCAGCACTAGGACAACTCCCTTGTTTGAAATTCCTTTCCGTTAAAGGGATGCATGGAATAAGAGTGGTGACGGAAGAATTCTATGGCAGATTGTCGTCCAAAAAGCCTTTTAACTGTCTTGAGAAGCTTGAATTTGAAGATATGACGGAGTGGAAGCAATGGCACGCACTAGGAATTGGAGAGTTCCCTACACTTGAGAACCTTTCAATTAAAAATTGCCCTGAGCTCAGTTTGGAGATACCCATCCAATTTTCTAGTTTAAAAAGGTTAGAAGTTGTTGGTTGTCCAGTTGTTATTGATGATGCTCAACTGTTTAGATCCCAACTTAAAGCAATGAAGCAGATTGAGGAAATATATATATGGGATTGTAAGTCTGTTACCTCCTTTCCTTTTAGCATACTGCCAACTACCTTGAAGAGAATACAGATATCTCATTGCCCGAAATTGAGATTGGAGGCGCCAGTTTGTGAGATGTTTGTGGAGTATTTGAGTGTGAAGGATTGTGGTTGTGTAGATGATATATCACCTGAGTTTCTCCCAACAGCACGTGAATTGAGTATTGAAAATTGCCAGAACGTTACTAGGTTTTTGATTCCTACTGCCACTGAAACTCTCCATATTCGGAATTGTGAGAATGTTGAAAAACTATCGGTGGCATGTGGAGGAGCGGCCCAGATGACGTTACTGGATATCTATGGCTGTAAGAAGCTCAAGTGTCTTCCAGAACTCCTTCCATCTCTCAAGGAACTGCAACTGTCTGATTGTCCAGAAATAGAAGGAGAATTGCCCTTCAATTTACAAGAACTCTATATCAGTAATTGCAAGAAACTGGTGAATGGCCGAAAGCAGTGGCATTTACAGAGACTCACAGAGTTATGGATCATTCATGATGGGAGTGACGAAGATATTGAACATTGGGAGTTGCCTTCCTCTATTCAGAGTCTTACCATATGCAATCTGATAACATTAAGCAGCCAACATCTCAAAAGCCTCACCTCTCTTCAATATCTAGATATTGAGGGTAATTTATCTCGGATTCAGTCACAAGGCCAGCTTTCCTCCTTTTCTCACCTCACTTCGCTTCAAGCTCTACAAATCCGTAATCTCCAATCACTTGCTGAATCAGCACAGCCCTCCTCCCTCTCTCACCTGACCATCTCCGATTGCCCTAATCTCCAATCACTTGCTGAATCAGCGCTGCCCTCCTCCCTCTCTCACCTGGGCATCTCCGATTGCTCTAATCTCCAATCACTTGCTGAATCAGCACTGCCATCCTCCCTCTCTCACCTGAACATCTCCGATTGCCCTAATCTCCAATCCCTTCCATCAAAAGGGATGCCCTCTTCCCTCTCTGAACTATCGATTTCCGAATGTCCATTGCTCAAACCACTACTAGAATTTGAAAAGGGGGAGTACTGGCCACAAATTGCTCATATCCCCACCATAGAGATCGATGGGGAATGCATGTAA
| Download sequence region |
Get flanking sequences on SL2.50ch11
|
mRNA Solyc11g071430.1.1
mRNA Solyc11g071430.1.1
|
Ontology terms
Ontology terms
| terms associated with this mRNA |
cDNA sequence
cDNA sequence
| spliced cDNA sequence, including UTRs |
>Solyc11g071430.1.1 Cc-nbs-lrr, resistance protein
ATGTTTCGGAAGCACAAGGATCATGTTAAGCTCTTAAAGAAGCTGAAAATGACTTTGTGTGGTCTTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAATCCATCTGTGAGCGACTGGCTTAATGAGCTTCGAGATGCTGTTGACTCTGCTGAAAATTTAATAGAAGAAGTCAATTATGAAGCTTTGAGGCTTAAGGTGGAAGGCCAGCATCAAAATCTTGCTGAAACAAGCAACAAACAAGTAAGTGACCTCAACTTGTGCTTGAGTGATGATTTCTTTCGTAACATAAAGGATAAGTTGGAAGAAACTATTGAAACGTTGGAGGTGTTGGAAAAGCAAATTGGTCGCCTTGGCTTAAAGGAGTATTTTATTTCGACCAAACAAGAAACTAGAACACCTTCAACTTCTTTGGTTGTTGATTCTGGTATCTTTGGAAGGCAGAATGAAATAGAGGATTTGGTTGGCCGTTTGTTGTCTATGGATACAAAGGGAAAAAATTTAGCTGTAGTTCCTATTGTTGGAATGGGCGGCCTGGGTAAGACAACACTTGCTAAGGCGGTTTACAATGATGAGAGAGTGAAGAAACATTTTGGTTTGACAGCTTGGTTTTGTGTTTCTGAGCTTCAAGTCAAAGTGAAGGAAAGTTTGAAGGGAAAGAAGTTTCTTATTGTTTTGGATGATGTGTGGAATGACAACTACAACGAGTGGGATGACTTGAGAAACATTTTTGTACAAGGAGATATAGGAAGTAAGATCATTGTGACGACACGCAAAAACAGTGTTGCCTTGATGATGGGAAATGAGCAAATTAGCATGAACAATTTGTCTACTGAAGCCTCTTGGTCTTTGTTTAAAAGACATGCATTTGAAAACATGAATCCTATGGGATATCCGGAACTCGAAGAGGTCGGAAAACAAATTGCAGCTAAGTGTAAAGGACTGCCCTTAGCTCTGAAGACACTCGCTGGCATGTTATGCTCCAAATCAGAGATTGATGAGTGGAAACGTATTTTGAGAAGTGAAATATGGGAGCTGCGAGACAATGACATATTACCAGCGTTGATGTTGAGCTACAATGATCTTCCCGCACATTTAAAGCGATGCTTTTGTTTTTGTGCAATATTTCCTAAAGATTATCCATTTAGGAAAGAACAAGTTATTCATCTATGGATTGCCAATGGTCTCGTACCAGTGAAAGATGAAATAAATCAAGATTTAGGCAACCAATTCTTTCTCGAGTTGAGTTCAAGATCATTATTTGAAAGGGTCCCAAATCCTTCTGAAGGAAACATAAAGGAATTATTCCTAATGCATGACCTTGTCAATGATTTAGCCCAACTTGCATCTTCAAAACTTTGTATCAGGTTGGAAGAGAGCCAAGGATCTCATATGTTGGAAAAAAGTCGGCATTTATCATATTCTATGGTCAATGATGGTGAGTTTGAGAAATTGACACCCCTCTGCAAATTGGAGGGGCTGAGGACTTTGCTTCCGATATGTATTAGTGTCAATTATTGTTATCACCCTCTAAGCAAGAGGGTGTTGCATAACATACTGCCTACACTAAGATTCTTGAGGGTACTATCATTCTCTCATTACAAGATTGAGGAGTTGCCAAATGACTTGTTTATCAAATTAAAGCTCCTCAGATTTTTGGACCTTTCTGAGACATGGATTAAAAAGTTGCCAGATTCCATATGTGGATTGTATAACTTAGAGACACTTCTCCTGTCATCTTGTTGTTCTCTTAAGGAGCTACCGCTGCATATGGAGAAGTTGATTAACTTGCGTCATCTTGACATAAGCAACACTTGGCGCTTGAAGATGCCACTACATCTGAGCAGGTTGAAAAGCCTCCAAGTGTTAGTGGGAGCCAAGTTTCTTCTAGGTGTTTGGAGAACGGAAGATTTGGGTGAAGCAAAAAACTTATATGGATCTCTATCAATTCTAGAGTTGGAAAATGTGGTTGATAGAAGGGAAGCTGTGAAGGCAAAGATGAGGGAGAAGAATCATGTTGACAAGTTATCTTTGAAGTGGAGTGAAAGTATTAGTGCTGACAATTCACATACAGAAAGAGACATACTTGATGAGCTATGCCCACATAAAAACATAAAAGAAGTCAAAATCATTGGATATAGAGGGACAAACTTTCCCGATTGGGTTGCTGATCCTTTGTTTCTTAAACTGGTGAAATTGTCTCTTAGAAACTGCAAGAACTGTTATTCCTTGCCAGCACTAGGACAACTCCCTTGTTTGAAATTCCTTTCCGTTAAAGGGATGCATGGAATAAGAGTGGTGACGGAAGAATTCTATGGCAGATTGTCGTCCAAAAAGCCTTTTAACTGTCTTGAGAAGCTTGAATTTGAAGATATGACGGAGTGGAAGCAATGGCACGCACTAGGAATTGGAGAGTTCCCTACACTTGAGAACCTTTCAATTAAAAATTGCCCTGAGCTCAGTTTGGAGATACCCATCCAATTTTCTAGTTTAAAAAGGTTAGAAGTTGTTGGTTGTCCAGTTGTTATTGATGATGCTCAACTGTTTAGATCCCAACTTAAAGCAATGAAGCAGATTGAGGAAATATATATATGGGATTGTAAGTCTGTTACCTCCTTTCCTTTTAGCATACTGCCAACTACCTTGAAGAGAATACAGATATCTCATTGCCCGAAATTGAGATTGGAGGCGCCAGTTTGTGAGATGTTTGTGGAGTATTTGAGTGTGAAGGATTGTGGTTGTGTAGATGATATATCACCTGAGTTTCTCCCAACAGCACGTGAATTGAGTATTGAAAATTGCCAGAACGTTACTAGGTTTTTGATTCCTACTGCCACTGAAACTCTCCATATTCGGAATTGTGAGAATGTTGAAAAACTATCGGTGGCATGTGGAGGAGCGGCCCAGATGACGTTACTGGATATCTATGGCTGTAAGAAGCTCAAGTGTCTTCCAGAACTCCTTCCATCTCTCAAGGAACTGCAACTGTCTGATTGTCCAGAAATAGAAGGAGAATTGCCCTTCAATTTACAAGAACTCTATATCAGTAATTGCAAGAAACTGGTGAATGGCCGAAAGCAGTGGCATTTACAGAGACTCACAGAGTTATGGATCATTCATGATGGGAGTGACGAAGATATTGAACATTGGGAGTTGCCTTCCTCTATTCAGAGTCTTACCATATGCAATCTGATAACATTAAGCAGCCAACATCTCAAAAGCCTCACCTCTCTTCAATATCTAGATATTGAGGGTAATTTATCTCGGATTCAGTCACAAGGCCAGCTTTCCTCCTTTTCTCACCTCACTTCGCTTCAAGCTCTACAAATCCGTAATCTCCAATCACTTGCTGAATCAGCACAGCCCTCCTCCCTCTCTCACCTGACCATCTCCGATTGCCCTAATCTCCAATCACTTGCTGAATCAGCGCTGCCCTCCTCCCTCTCTCACCTGGGCATCTCCGATTGCTCTAATCTCCAATCACTTGCTGAATCAGCACTGCCATCCTCCCTCTCTCACCTGAACATCTCCGATTGCCCTAATCTCCAATCCCTTCCATCAAAAGGGATGCCCTCTTCCCTCTCTGAACTATCGATTTCCGAATGTCCATTGCTCAAACCACTACTAGAATTTGAAAAGGGGGAGTACTGGCCACAAATTGCTCATATCCCCACCATAGAGATCGATGGGGAATGCATGTAA
ATGTTTCGGAAGCACAAGGATCATGTTAAGCTCTTAAAGAAGCTGAAAATGACTTTGTGTGGTCTTCAGATTGTGCTAAGTGATGCAGAGAATAAGCAAGCATCAAATCCATCTGTGAGCGACTGGCTTAATGAGCTTCGAGATGCTGTTGACTCTGCTGAAAATTTAATAGAAGAAGTCAATTATGAAGCTTTGAGGCTTAAGGTGGAAGGCCAGCATCAAAATCTTGCTGAAACAAGCAACAAACAAGTAAGTGACCTCAACTTGTGCTTGAGTGATGATTTCTTTCGTAACATAAAGGATAAGTTGGAAGAAACTATTGAAACGTTGGAGGTGTTGGAAAAGCAAATTGGTCGCCTTGGCTTAAAGGAGTATTTTATTTCGACCAAACAAGAAACTAGAACACCTTCAACTTCTTTGGTTGTTGATTCTGGTATCTTTGGAAGGCAGAATGAAATAGAGGATTTGGTTGGCCGTTTGTTGTCTATGGATACAAAGGGAAAAAATTTAGCTGTAGTTCCTATTGTTGGAATGGGCGGCCTGGGTAAGACAACACTTGCTAAGGCGGTTTACAATGATGAGAGAGTGAAGAAACATTTTGGTTTGACAGCTTGGTTTTGTGTTTCTGAGCTTCAAGTCAAAGTGAAGGAAAGTTTGAAGGGAAAGAAGTTTCTTATTGTTTTGGATGATGTGTGGAATGACAACTACAACGAGTGGGATGACTTGAGAAACATTTTTGTACAAGGAGATATAGGAAGTAAGATCATTGTGACGACACGCAAAAACAGTGTTGCCTTGATGATGGGAAATGAGCAAATTAGCATGAACAATTTGTCTACTGAAGCCTCTTGGTCTTTGTTTAAAAGACATGCATTTGAAAACATGAATCCTATGGGATATCCGGAACTCGAAGAGGTCGGAAAACAAATTGCAGCTAAGTGTAAAGGACTGCCCTTAGCTCTGAAGACACTCGCTGGCATGTTATGCTCCAAATCAGAGATTGATGAGTGGAAACGTATTTTGAGAAGTGAAATATGGGAGCTGCGAGACAATGACATATTACCAGCGTTGATGTTGAGCTACAATGATCTTCCCGCACATTTAAAGCGATGCTTTTGTTTTTGTGCAATATTTCCTAAAGATTATCCATTTAGGAAAGAACAAGTTATTCATCTATGGATTGCCAATGGTCTCGTACCAGTGAAAGATGAAATAAATCAAGATTTAGGCAACCAATTCTTTCTCGAGTTGAGTTCAAGATCATTATTTGAAAGGGTCCCAAATCCTTCTGAAGGAAACATAAAGGAATTATTCCTAATGCATGACCTTGTCAATGATTTAGCCCAACTTGCATCTTCAAAACTTTGTATCAGGTTGGAAGAGAGCCAAGGATCTCATATGTTGGAAAAAAGTCGGCATTTATCATATTCTATGGTCAATGATGGTGAGTTTGAGAAATTGACACCCCTCTGCAAATTGGAGGGGCTGAGGACTTTGCTTCCGATATGTATTAGTGTCAATTATTGTTATCACCCTCTAAGCAAGAGGGTGTTGCATAACATACTGCCTACACTAAGATTCTTGAGGGTACTATCATTCTCTCATTACAAGATTGAGGAGTTGCCAAATGACTTGTTTATCAAATTAAAGCTCCTCAGATTTTTGGACCTTTCTGAGACATGGATTAAAAAGTTGCCAGATTCCATATGTGGATTGTATAACTTAGAGACACTTCTCCTGTCATCTTGTTGTTCTCTTAAGGAGCTACCGCTGCATATGGAGAAGTTGATTAACTTGCGTCATCTTGACATAAGCAACACTTGGCGCTTGAAGATGCCACTACATCTGAGCAGGTTGAAAAGCCTCCAAGTGTTAGTGGGAGCCAAGTTTCTTCTAGGTGTTTGGAGAACGGAAGATTTGGGTGAAGCAAAAAACTTATATGGATCTCTATCAATTCTAGAGTTGGAAAATGTGGTTGATAGAAGGGAAGCTGTGAAGGCAAAGATGAGGGAGAAGAATCATGTTGACAAGTTATCTTTGAAGTGGAGTGAAAGTATTAGTGCTGACAATTCACATACAGAAAGAGACATACTTGATGAGCTATGCCCACATAAAAACATAAAAGAAGTCAAAATCATTGGATATAGAGGGACAAACTTTCCCGATTGGGTTGCTGATCCTTTGTTTCTTAAACTGGTGAAATTGTCTCTTAGAAACTGCAAGAACTGTTATTCCTTGCCAGCACTAGGACAACTCCCTTGTTTGAAATTCCTTTCCGTTAAAGGGATGCATGGAATAAGAGTGGTGACGGAAGAATTCTATGGCAGATTGTCGTCCAAAAAGCCTTTTAACTGTCTTGAGAAGCTTGAATTTGAAGATATGACGGAGTGGAAGCAATGGCACGCACTAGGAATTGGAGAGTTCCCTACACTTGAGAACCTTTCAATTAAAAATTGCCCTGAGCTCAGTTTGGAGATACCCATCCAATTTTCTAGTTTAAAAAGGTTAGAAGTTGTTGGTTGTCCAGTTGTTATTGATGATGCTCAACTGTTTAGATCCCAACTTAAAGCAATGAAGCAGATTGAGGAAATATATATATGGGATTGTAAGTCTGTTACCTCCTTTCCTTTTAGCATACTGCCAACTACCTTGAAGAGAATACAGATATCTCATTGCCCGAAATTGAGATTGGAGGCGCCAGTTTGTGAGATGTTTGTGGAGTATTTGAGTGTGAAGGATTGTGGTTGTGTAGATGATATATCACCTGAGTTTCTCCCAACAGCACGTGAATTGAGTATTGAAAATTGCCAGAACGTTACTAGGTTTTTGATTCCTACTGCCACTGAAACTCTCCATATTCGGAATTGTGAGAATGTTGAAAAACTATCGGTGGCATGTGGAGGAGCGGCCCAGATGACGTTACTGGATATCTATGGCTGTAAGAAGCTCAAGTGTCTTCCAGAACTCCTTCCATCTCTCAAGGAACTGCAACTGTCTGATTGTCCAGAAATAGAAGGAGAATTGCCCTTCAATTTACAAGAACTCTATATCAGTAATTGCAAGAAACTGGTGAATGGCCGAAAGCAGTGGCATTTACAGAGACTCACAGAGTTATGGATCATTCATGATGGGAGTGACGAAGATATTGAACATTGGGAGTTGCCTTCCTCTATTCAGAGTCTTACCATATGCAATCTGATAACATTAAGCAGCCAACATCTCAAAAGCCTCACCTCTCTTCAATATCTAGATATTGAGGGTAATTTATCTCGGATTCAGTCACAAGGCCAGCTTTCCTCCTTTTCTCACCTCACTTCGCTTCAAGCTCTACAAATCCGTAATCTCCAATCACTTGCTGAATCAGCACAGCCCTCCTCCCTCTCTCACCTGACCATCTCCGATTGCCCTAATCTCCAATCACTTGCTGAATCAGCGCTGCCCTCCTCCCTCTCTCACCTGGGCATCTCCGATTGCTCTAATCTCCAATCACTTGCTGAATCAGCACTGCCATCCTCCCTCTCTCACCTGAACATCTCCGATTGCCCTAATCTCCAATCCCTTCCATCAAAAGGGATGCCCTCTTCCCTCTCTGAACTATCGATTTCCGAATGTCCATTGCTCAAACCACTACTAGAATTTGAAAAGGGGGAGTACTGGCCACAAATTGCTCATATCCCCACCATAGAGATCGATGGGGAATGCATGTAA
Protein sequence
Protein sequence
| translated polypeptide sequence |
>Solyc11g071430.1.1 Cc-nbs-lrr, resistance protein
MFRKHKDHVKLLKKLKMTLCGLQIVLSDAENKQASNPSVSDWLNELRDAVDSAENLIEEVNYEALRLKVEGQHQNLAETSNKQVSDLNLCLSDDFFRNIKDKLEETIETLEVLEKQIGRLGLKEYFISTKQETRTPSTSLVVDSGIFGRQNEIEDLVGRLLSMDTKGKNLAVVPIVGMGGLGKTTLAKAVYNDERVKKHFGLTAWFCVSELQVKVKESLKGKKFLIVLDDVWNDNYNEWDDLRNIFVQGDIGSKIIVTTRKNSVALMMGNEQISMNNLSTEASWSLFKRHAFENMNPMGYPELEEVGKQIAAKCKGLPLALKTLAGMLCSKSEIDEWKRILRSEIWELRDNDILPALMLSYNDLPAHLKRCFCFCAIFPKDYPFRKEQVIHLWIANGLVPVKDEINQDLGNQFFLELSSRSLFERVPNPSEGNIKELFLMHDLVNDLAQLASSKLCIRLEESQGSHMLEKSRHLSYSMVNDGEFEKLTPLCKLEGLRTLLPICISVNYCYHPLSKRVLHNILPTLRFLRVLSFSHYKIEELPNDLFIKLKLLRFLDLSETWIKKLPDSICGLYNLETLLLSSCCSLKELPLHMEKLINLRHLDISNTWRLKMPLHLSRLKSLQVLVGAKFLLGVWRTEDLGEAKNLYGSLSILELENVVDRREAVKAKMREKNHVDKLSLKWSESISADNSHTERDILDELCPHKNIKEVKIIGYRGTNFPDWVADPLFLKLVKLSLRNCKNCYSLPALGQLPCLKFLSVKGMHGIRVVTEEFYGRLSSKKPFNCLEKLEFEDMTEWKQWHALGIGEFPTLENLSIKNCPELSLEIPIQFSSLKRLEVVGCPVVIDDAQLFRSQLKAMKQIEEIYIWDCKSVTSFPFSILPTTLKRIQISHCPKLRLEAPVCEMFVEYLSVKDCGCVDDISPEFLPTARELSIENCQNVTRFLIPTATETLHIRNCENVEKLSVACGGAAQMTLLDIYGCKKLKCLPELLPSLKELQLSDCPEIEGELPFNLQELYISNCKKLVNGRKQWHLQRLTELWIIHDGSDEDIEHWELPSSIQSLTICNLITLSSQHLKSLTSLQYLDIEGNLSRIQSQGQLSSFSHLTSLQALQIRNLQSLAESAQPSSLSHLTISDCPNLQSLAESALPSSLSHLGISDCSNLQSLAESALPSSLSHLNISDCPNLQSLPSKGMPSSLSELSISECPLLKPLLEFEKGEYWPQIAHIPTIEIDGECM*
MFRKHKDHVKLLKKLKMTLCGLQIVLSDAENKQASNPSVSDWLNELRDAVDSAENLIEEVNYEALRLKVEGQHQNLAETSNKQVSDLNLCLSDDFFRNIKDKLEETIETLEVLEKQIGRLGLKEYFISTKQETRTPSTSLVVDSGIFGRQNEIEDLVGRLLSMDTKGKNLAVVPIVGMGGLGKTTLAKAVYNDERVKKHFGLTAWFCVSELQVKVKESLKGKKFLIVLDDVWNDNYNEWDDLRNIFVQGDIGSKIIVTTRKNSVALMMGNEQISMNNLSTEASWSLFKRHAFENMNPMGYPELEEVGKQIAAKCKGLPLALKTLAGMLCSKSEIDEWKRILRSEIWELRDNDILPALMLSYNDLPAHLKRCFCFCAIFPKDYPFRKEQVIHLWIANGLVPVKDEINQDLGNQFFLELSSRSLFERVPNPSEGNIKELFLMHDLVNDLAQLASSKLCIRLEESQGSHMLEKSRHLSYSMVNDGEFEKLTPLCKLEGLRTLLPICISVNYCYHPLSKRVLHNILPTLRFLRVLSFSHYKIEELPNDLFIKLKLLRFLDLSETWIKKLPDSICGLYNLETLLLSSCCSLKELPLHMEKLINLRHLDISNTWRLKMPLHLSRLKSLQVLVGAKFLLGVWRTEDLGEAKNLYGSLSILELENVVDRREAVKAKMREKNHVDKLSLKWSESISADNSHTERDILDELCPHKNIKEVKIIGYRGTNFPDWVADPLFLKLVKLSLRNCKNCYSLPALGQLPCLKFLSVKGMHGIRVVTEEFYGRLSSKKPFNCLEKLEFEDMTEWKQWHALGIGEFPTLENLSIKNCPELSLEIPIQFSSLKRLEVVGCPVVIDDAQLFRSQLKAMKQIEEIYIWDCKSVTSFPFSILPTTLKRIQISHCPKLRLEAPVCEMFVEYLSVKDCGCVDDISPEFLPTARELSIENCQNVTRFLIPTATETLHIRNCENVEKLSVACGGAAQMTLLDIYGCKKLKCLPELLPSLKELQLSDCPEIEGELPFNLQELYISNCKKLVNGRKQWHLQRLTELWIIHDGSDEDIEHWELPSSIQSLTICNLITLSSQHLKSLTSLQYLDIEGNLSRIQSQGQLSSFSHLTSLQALQIRNLQSLAESAQPSSLSHLTISDCPNLQSLAESALPSSLSHLGISDCSNLQSLAESALPSSLSHLNISDCPNLQSLPSKGMPSSLSELSISECPLLKPLLEFEKGEYWPQIAHIPTIEIDGECM*
Gene model matches
Gene model matches
|
SGN Unigenes
SGN Unigenes
| [Associate new unigene] |
Unigene ID:
[loading...]
GenBank accessions
GenBank accessions
| [Associate new genbank sequence] |
AF118127 Lycopersicon esculentum disease resistance protein I2 (I2) gene, complete cds.
| Other genome matches | None |
Literature annotations [13]
Literature annotations [13]
| [Associate publication] [Matching publications] |
The I2C family from the wilt disease resistance locus I2 belongs to the nucleotide binding, leucine-rich repeat superfamily of plant resistance genes.
The Plant cell (1997)
Show / hide abstract
Show / hide abstract
Characterization of plant resistance genes is an important step in understanding plant defense mechanisms. Fusarium oxysporum f sp lycopersici is the causal agent of a vascular wilt disease in tomato. Genes conferring resistance to plant vascular diseases have yet to be described molecularly. Members of a new multigene family, complex I2C, were isolated by map-based cloning from the I2 F. o. lycopersici race 2 resistance locus. The genes show structural similarity to the group of recently isolated resistance genes that contain a nucleotide binding motif and leucine-rich repeats. Importantly, the presence of I2C antisense transgenes abrogated race 2 but not race 1 resistance in otherwise normal plants. Expression of the complete sense I2C-1 transgene conferred significant but partial resistance to F. o. lycopersici race 2. All members of the I2C gene family have been mapped genetically and are dispersed on three different chromosomes. Some of the I2C members cosegregate with other tomato resistance loci. Comparison within the leucine-rich repeat region of I2C gene family members shows that they differ from each other mainly by insertions or deletions.
Ori, N. Eshed, Y. Paran, I. Presting, G. Aviv, D. Tanksley, S. Zamir, D. Fluhr, R.
The Plant cell.
1997.
9(4).
521-32.
Dissection of the fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy.
The Plant cell (1998)
Show / hide abstract
Show / hide abstract
The I2 locus in tomato confers resistance to race 2 of the soil-borne fungus Fusarium oxysporum f sp lycopersici. The selective restriction fragment amplification (AFLP) positional cloning strategy was used to identify I2 in the tomato genome. A yeast artificial chromosome (YAC) clone covering approximately 750 kb encompassing the I2 locus was isolated, and the AFLP technique was used to derive tightly linked AFLP markers from this YAC clone. Genetic complementation analysis in transgenic R1 plants using a set of overlapping cosmids covering the I2 locus revealed three cosmids giving full resistance to F. o. lycopersici race 2. These cosmids shared a 7-kb DNA fragment containing an open reading frame encoding a protein with similarity to the nucleotide binding site leucine-rich repeat family of resistance genes. At the I2 locus, we identified six additional homologs that included the recently identified I2C-1 and I2C-2 genes. However, cosmids containing the I2C-1 or I2C-2 gene could not confer resistance to plants, indicating that these members are not the functional resistance genes. Alignments between the various members of the I2 gene family revealed two significant variable regions within the leucine-rich repeat region. They consisted of deletions or duplications of one or more leucine-rich repeats. We propose that one or both of these leucine-rich repeats are involved in Fusarium wilt resistance with I2 specificity.
Simons, G. Groenendijk, J. Wijbrandi, J. Reijans, M. Groenen, J. Diergaarde, P. Van der Lee, T. Bleeker, M. Onstenk, J. de Both, M. Haring, M. Mes, J. Cornelissen, B. Zabeau, M. Vos, P.
The Plant cell.
1998.
10(6).
1055-68.
Comparative genetics of nucleotide binding site-leucine rich repeat resistance gene homologues in the genomes of two dicotyledons: tomato and arabidopsis.
Genetics (2000)
Show / hide abstract
Show / hide abstract
The presence of a single resistance (R) gene allele can determine plant disease resistance. The protein products of such genes may act as receptors that specifically interact with pathogen-derived factors. Most functionally defined R-genes are of the nucleotide binding site-leucine rich repeat (NBS-LRR) supergene family and are present as large multigene families. The specificity of R-gene interactions together with the robustness of plant-pathogen interactions raises the question of their gene number and diversity in the genome. Genomic sequences from tomato showing significant homology to genes conferring race-specific resistance to pathogens were identified by systematically "scanning" the genome using a variety of primer pairs based on ubiquitous NBS motifs. Over 70 sequences were isolated and 10% are putative pseudogenes. Mapping of the amplified sequences on the tomato genetic map revealed their organization as mixed clusters of R-gene homologues that showed in many cases linkage to genetically characterized tomato resistance loci. Interspecific examination within Lycopersicon showed the existence of a null allele. Consideration of the tomato and potato comparative genetic maps unveiled conserved syntenic positions of R-gene homologues. Phylogenetic clustering of R-gene homologues within tomato and other Solanaceae family members was observed but not with R-gene homologues from Arabidopsis thaliana. Our data indicate remarkably rapid evolution of R-gene homologues during diversification of plant families.
Pan, Q. Liu, YS. Budai-Hadrian, O. Sela, M. Carmel-Goren, L. Zamir, D. Fluhr, R.
Genetics.
2000.
155(1).
309-22.
Expression of the Fusarium resistance gene I-2 colocalizes with the site of fungal containment.
The Plant journal : for cell and molecular biology (2000)
Show / hide abstract
Show / hide abstract
The tomato resistance gene I-2 is one of at least six members of a gene family that are expressed at low levels in the roots, stems and leaves of young tomato plants. Plants transformed with constructs containing a functional I-2 promoter fused to the beta-glucuronidase (GUS) reporter gene were used in detailed expression studies. Highest GUS activity was found in stems of young tomato plants. Histochemical analysis revealed that the I-2 promoter drives expression of the reporter gene in vascular tissue of fruits, leaves, stems and mature roots. In younger roots, expression was most abundant at the base of lateral root primordia. Microscopical analysis of young tomato plants revealed expression in tissue surrounding the xylem vessels. We show that in resistant plants, fungal growth into this region of the vascular tissue is prevented, suggesting a correlation with the I-2-mediated resistance response.
Mes, JJ. van Doorn, AA. Wijbrandi, J. Simons, G. Cornelissen, BJ. Haring, MA.
The Plant journal : for cell and molecular biology.
2000.
23(2).
183-93.
Genome-wide dissection of Fusarium resistance in tomato reveals multiple complex loci.
Molecular genetics and genomics : MGG (2001)
Show / hide abstract
Show / hide abstract
Resistance to different pathogenic races of Fusarium oxysporum f. sp. lycopersici (F. o. lycopersici) was explored at two genomic levels in tomato. Six independent Fusarium resistance loci were identified by comparing the responses of a complete set of 53 lines carrying different introgressed regions of the Lycopersicon pennellii genome in a L. esculentum background. The loci confer varying degrees of resistance to different races of the pathogen. Corresponding map positions from different tomato species were aligned and in some cases revealed parallel resistance to F. o. lycopersici with qualitative changes in race specificities. One of the loci identified corresponds to the previously characterized complex resistance locus I2, which is involved in resistance to F. o. lycopersici race 2. A novel member of this locus, I2C-5, which belongs to the NBS-LRR family of resistance genes, was cloned and shown to confer partial resistance in transgenic plants. Thus, at a particular complex locus gene members can confer full or partial resistance to F. o. lycopersici race 2. The results of our whole-genome mapping analysis underline the robust independent origin of resistance to a particular disease and demonstrate the conservation of resistance features at syntenic loci, together with the rapid diversification of genes for innate resistance within loci.
Sela-Buurlage, M. Budai-Hadrian, O. Pan, Q. Carmel-Goren, L. Vunsch, R. Zamir, D. Fluhr, R.
Molecular genetics and genomics : MGG.
2001.
265(6).
1104-11.
Diversity, distribution, and ancient taxonomic relationships within the TIR and non-TIR NBS-LRR resistance gene subfamilies.
Journal of molecular evolution (2002)
Show / hide abstract
Show / hide abstract
Phylogenetic relationships among the NBS-LRR (nucleotide binding site-leucine-rich repeat) resistance gene homologues (RGHs) from 30 genera and nine families were evaluated relative to phylogenies for these taxa. More than 800 NBS-LRR RGHs were analyzed, primarily from Fabaceae, Brassicaceae, Poaceae, and Solanaceae species, but also from representatives of other angiosperm and gymnosperm families. Parsimony, maximum likelihood, and distance methods were used to classify these RGHs relative to previously observed gene subfamilies as well as within more closely related sequence clades. Grouping sequences using a distance cutoff of 250 PAM units (point accepted mutations per 100 residues) identified at least five ancient sequence clades with representatives from several plant families: the previously observed TIR gene subfamily and a minimum of four deep splits within the non-TIR gene subfamily. The deep splits in the non-TIR subfamily are also reflected in comparisons of amino acid substitution rates in various species and in ratios of nonsynonymous-to-synonymous nucleotide substitution rates ( K(A)/ K(S) values) in Arabidopsis thaliana. Lower K(A)/ K(S) values in the TIR than the non-TIR sequences suggest greater functional constraints in the TIR subfamily. At least three of the five identified ancient clades appear to predate the angiosperm-gymnosperm radiation. Monocot sequences are absent from the TIR subfamily, as observed in previous studies. In both subfamilies, clades with sequences separated by approximately 150 PAM units are family but not genus specific, providing a rough measure of minimum dates for the first diversification event within these clades. Within any one clade, particular taxa may be dramatically over- or underrepresented, suggesting preferential expansions or losses of certain RGH types within particular taxa and suggesting that no one species will provide models for all major sequence types in other taxa.
Cannon, SB. Zhu, H. Baumgarten, AM. Spangler, R. May, G. Cook, DR. Young, ND.
Journal of molecular evolution.
2002.
54(4).
548-62.
The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase activity.
The Plant cell (2002)
Show / hide abstract
Show / hide abstract
Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP.
Tameling, WI. Elzinga, SD. Darmin, PS. Vossen, JH. Takken, FL. Haring, MA. Cornelissen, BJ.
The Plant cell.
2002.
14(11).
2929-39.
The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities.
Molecular plant-microbe interactions : MPMI (2004)
Show / hide abstract
Show / hide abstract
The R3 locus of potato (Solanum tuberosum L.) confers full resistance to avirulent isolates of Phytophthora infestans, the causal agent of late blight. R3 resides in the distal part of chromosome 11 and segregates in a potato mapping population, from which a well-saturated amplified fragment length polymorphism map is available. Using a population of 1,748 plants, we constructed a high-resolution genetic map at the R3 locus. Using the combination of fine mapping and accurate disease testing with specific P. infestans isolates, we detected that the R3 locus is composed of two genes with distinct specificities. The two genes R3a and R3b are 0.4 cM apart and have both been introgressed from S. demissum, the 'donor' species of most characterized race-specific R genes to P. infestans. A natural recombinant between R3a and R3b was discovered in one accession of S. demissum. The synteny between the R3 locus and the tomato I2 locus is discussed.
Huang, S. Vleeshouwers, VG. Werij, JS. Hutten, RC. van Eck, HJ. Visser, RG. Jacobsen, E.
Molecular plant-microbe interactions : MPMI.
2004.
17(4).
428-35.
Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato.
The Plant journal : for cell and molecular biology (2005)
Show / hide abstract
Show / hide abstract
Comparative genomics provides a tool to utilize the exponentially increasing sequence information from model plants to clone agronomically important genes from less studied crop species. Plant disease resistance (R) loci frequently lack synteny between related species of cereals and crucifers but appear to be positionally well conserved in the Solanaceae. In this report, we adopted a local RGA approach using genomic information from the model Solanaceous plant tomato to isolate R3a, a potato gene that confers race-specific resistance to the late blight pathogen Phytophthora infestans. R3a is a member of the R3 complex locus on chromosome 11. Comparative analyses of the R3 complex locus with the corresponding I2 complex locus in tomato suggest that this is an ancient locus involved in plant innate immunity against oomycete and fungal pathogens. However, the R3 complex locus has evolved after divergence from tomato and the locus has experienced a significant expansion in potato without disruption of the flanking colinearity. This expansion has resulted in an increase in the number of R genes and in functional diversification, which has probably been driven by the co-evolutionary history between P. infestans and its host potato. Constitutive expression was observed for the R3a gene, as well as some of its paralogues whose functions remain unknown.
Huang, Sanwen. van, der. Kuang, Hanhui. Vleeshouwers, Vivianne. Zhang, Ningwen. Borm, Theo. van, Eck. Baker, Barbara. Jacobsen, Evert. Visser, Richard.
The Plant journal : for cell and molecular biology.
2005.
42(2).
251-61.
Mutations in the NB-ARC domain of I-2 that impair ATP hydrolysis cause autoactivation.
Plant physiology (2006)
Show / hide abstract
Show / hide abstract
Resistance (R) proteins in plants confer specificity to the innate immune system. Most R proteins have a centrally located NB-ARC (nucleotide-binding adaptor shared by APAF-1, R proteins, and CED-4) domain. For two tomato (Lycopersicon esculentum) R proteins, I-2 and Mi-1, we have previously shown that this domain acts as an ATPase module that can hydrolyze ATP in vitro. To investigate the role of nucleotide binding and hydrolysis for the function of I-2 in planta, specific mutations were introduced in conserved motifs of the NB-ARC domain. Two mutations resulted in autoactivating proteins that induce a pathogen-independent hypersensitive response upon expression in planta. These mutant forms of I-2 were found to be impaired in ATP hydrolysis, but not in ATP binding, suggesting that the ATP- rather than the ADP-bound state of I-2 is the active form that triggers defense signaling. In addition, upon ADP binding, the protein displayed an increased affinity for ADP suggestive of a change of conformation. Based on these data, we propose that the NB-ARC domain of I-2, and likely of related R proteins, functions as a molecular switch whose state (on/off) depends on the nucleotide bound (ATP/ADP).
Tameling, WI. Vossen, JH. Albrecht, M. Lengauer, T. Berden, JA. Haring, MA. Cornelissen, BJ. Takken, FL.
Plant physiology.
2006.
140(4).
1233-45.
Pervasive purifying selection characterizes the evolution of I2 homologs.
Molecular plant-microbe interactions : MPMI (2006)
Show / hide abstract
Show / hide abstract
We sampled 384 sequences related to the Solanum pimpinellifolium (=Lycopersicon pimpinellifolium) disease resistance (R) gene 12 from six species, potato, S. demissum, tomato, eggplant, pepper, and tobacco. These species represent increasing phylogenetic distance from potato to tobacco, within the family Solanaceae. Using sequence data from the nucleotide binding site (NBS) region of this gene, we tested models of gene family evolution and inferred patterns of selection acting on the NBS gene region and I2 gene family. We find that the I2 family has diversified within the family Solanaceae for at least 14 million years and evolves through a slow birth-and-death process requiring approximately 12 million years to homogenize gene copies within a species. Analyses of selection resolved a general pattern of strong purifying selection acting on individual codon positions within the NBS and on NBS lineages through time. Surprisingly, we find nine codon positions strongly affected by positive selection and six pairs of codon positions demonstrating correlated amino acid substitutions. Evolutionary analyses serve as bioinformatic tools with which to sort through the vast R gene diversity in plants and find candidates for new resistance specificities or to identify specific amino acid positions important for biochemical function. The slow birth-and-death evolution of I2 genes suggests that some NBS-leucine rich repeat-mediated resistances may not be overcome rapidly by virulence evolution and that the natural diversity of R genes is a potentially valuable source for durable resistance.
Couch, BC. Spangler, R. Ramos, C. May, G.
Molecular plant-microbe interactions : MPMI.
2006.
19(3).
288-303.
The effector protein Avr2 of the xylem-colonizing fungus Fusarium oxysporum activates the tomato resistance protein I-2 intracellularly.
The Plant journal : for cell and molecular biology (2009)
Show / hide abstract
Show / hide abstract
To promote host colonization, many plant pathogens secrete effector proteins that either suppress or counteract host defences. However, when these effectors are recognized by the host's innate immune system, they trigger resistance rather than promoting virulence. Effectors are therefore key molecules in determining disease susceptibility or resistance. We show here that Avr2, secreted by the vascular wilt fungus Fusarium oxysporum f. sp. lycopersici (Fol), shows both activities: it is required for full virulence in a susceptible host and also triggers resistance in tomato plants carrying the resistance gene I-2. Point mutations in AVR2, causing single amino acid changes, are associated with I-2-breakingFol strains. These point mutations prevent recognition by I-2, both in tomato and when both genes are co-expressed in leaves of Nicotiana benthamiana. Fol strains carrying the Avr2 variants are equally virulent, showing that virulence and avirulence functions can be uncoupled. Although Avr2 is secreted into the xylem sap when Fol colonizes tomato, the Avr2 protein can be recognized intracellularly by I-2, implying uptake by host cells.
Houterman, PM. Ma, L. van Ooijen, G. de Vroomen, MJ. Cornelissen, BJ. Takken, FL. Rep, M.
The Plant journal : for cell and molecular biology.
2009.
58(6).
970-8.
Overview of tomato (Solanum lycopersicum) candidate pathogen recognition genes reveals important Solanum R locus dynamics.
The New phytologist (2013)
Show / hide abstract
Show / hide abstract
To investigate the genome-wide spatial arrangement of R loci, a complete catalogue of tomato (Solanum lycopersicum) and potato (Solanum tuberosum) nucleotide-binding site (NBS) NBS, receptor-like protein (RLP) and receptor-like kinase (RLK) gene repertories was generated. Candidate pathogen recognition genes were characterized with respect to structural diversity, phylogenetic relationships and chromosomal distribution. NBS genes frequently occur in clusters of related gene copies that also include RLP or RLK genes. This scenario is compatible with the existence of selective pressures optimizing coordinated transcription. A number of duplication events associated with lineage-specific evolution were discovered. These findings suggest that different evolutionary mechanisms shaped pathogen recognition gene cluster architecture to expand and to modulate the defence repertoire. Analysis of pathogen recognition gene clusters associated with documented resistance function allowed the identification of adaptive divergence events and the reconstruction of the evolution history of these loci. Differences in candidate pathogen recognition gene number and organization were found between tomato and potato. Most candidate pathogen recognition gene orthologues were distributed at less than perfectly matching positions, suggesting an ongoing lineage-specific rearrangement. Indeed, a local expansion of Toll/Interleukin-1 receptor (TIR)-NBS-leucine-rich repeat (LRR) (TNL) genes in the potato genome was evident. Taken together, these findings have implications for improved understanding of the mechanisms of molecular adaptive selection at Solanum R loci.
Andolfo, G. Sanseverino, W. Rombauts, S. Van de Peer, Y. Bradeen, JM. Carputo, D. Frusciante, L. Ercolano, MR.
The New phytologist.
2013.
197(1).
223-37.
Ontology annotations (1)
Ontology annotations (1)
| [Add ontology annotations] |
[loading...]
Related views
Related views
|
- Genomic details
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Your Lists
Public Lists
List Contents
List Validation Report: Failed
Elements not found:
Optional: Add Missing Accessions to A List
Mismatched case
Click the Adjust Case button to align the case in the list with what is in the database.
Multiple mismatched case
Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.
List elements matching a synonym
Multiple synonym matches
Fuzzy Search Results
Synonym Search Results
Available Seedlots
List Comparison
Your Datasets
Public Datasets
Dataset Contents
Dataset Validation Failed
Elements not found:
Your Calendar
Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?
Add New Event
Event Info
| Attribute | Value |
|---|---|
| Project Name: | |
| Start Date: | |
| End Date: | |
| Event Type: | |
| Event Description: | |
| Event Web URL: |
Edit Event
Login
Forgot Username
If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.
Reset Password
To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.
Create New User
Working


Links to external databases
Links to external databases
