This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.
Tomato locus lanceolate
| Locus details | Download GMOD XML | Note to Editors | Annotation guidelines | 
[loading edit links...] 
 | 
[loading...]
  
      
  | 
    
  | 
	 Links to external databases
	 Links to external databases
 | 
| Registry name: | None | [Associate registry name] | 
	 Notes and figures (0)
	 Notes and figures (0)
 | [Add notes, figures or images] | 
Success
The display image was set successfully.
| Image | Description | Type | 
|---|
	 Accessions and images (11)
	 Accessions and images (11)
 | [Associate accession] | 
	 Alleles (1)
	 Alleles (1)
 | [Add new Allele] | 
	 Associated loci (30)
	 Associated loci (30)
 | [Associate new locus] | 
[loading...] 
 | 
	 Associated loci - graphical view
	 Associated loci - graphical view
 | View lanceolate relationships in the stand-alone network browser | 
[loading...]  | [Legend] [Levels]  | 
	 SolCyc links
	 SolCyc links
 | 
[loading...]
	 Sequence annotations
	 Sequence annotations
 | 
	 Genome features
	 Genome features
 | 
	 Genomic sequence
	 Genomic sequence
 | unprocessed genomic sequence region underlying this gene | 
                
    
  >Solyc07g062680.1 SL2.50ch07:65369983..65371185
    
  
ATGGCAGAAACGTCAAGATTGGGTATAAGGAATACTGTAGGAGAGATTGTAGAAGTACAAGGAGGTCACATTGTGAGGTCTACGGGGCGGAAAGACCGCCACAGCAAGGTTTGCACAGCCAAAGGCCCCAGAGATCGCCGTGTGCGTCTCTCTGCTCATACTGCTATTCAGTTTTACGATGTGCAAGACCGCCTTGGTTATGATAGACCTAGTAAAGCTGTGGATTGGCTTATCAAAAAGGCAAAACCCGCCATTGATGAGCTAGCTGAGTTACCTGCCTGGAAACCTACAATTGGTACTGCATCTGCTGCTGCTGCTACTAACACCAATCTTGAACAGGAACAGGCTCAAAAACAGCAAGAAGATAACAACTTTGCATTTCAACAAGGAAATGTTAGTTTGTTTGATAATGTTGCTGGCCCTTCAAGTAAAAGAGCAATCGAAAGTAATACTGCTAGCTTTCTGCCTCCATCTTTAGAATCTGATGCTATTGCTGATACTATCAAATCTTTTTTCCCAATGGGTTCTTCAACCTCAGCTAACTCTTCAGCTATGCAGTTCCATAGCTTCCAAGAACCCCATATGTTATCAAGAGCCAATAGCCAGAACCAAGATTTGAGTCTCTCTTTACAGTTTCAAGATCCTATTTTGCTTCACCATCAAAACCAGCAAGCTCAACACCATAACCAAACTAACCATAGGGAACAAGAGCAAGTGCAGGGTCAAGCACCAGCCCACTTTGGAGGAAACACCCCACTTGGTTTTGACACCTCTGGCTGGTCTATGCATCAGAGACTTCGTTCTTGGAGTGACAGTAGAGAAATTGGCCCTGGTGGTAGTGGTGGAGCAGTAACAGGACCTGGTGGGTACTTGTTCAATTCGCCACCAGCACCGGCGCTGCTGCAGCAGCTATTCGGTCAAAATCAGTTTTTTTCTCAGAGGGGACCCCTTCAGTCCAGTAACACATCTTCGGTTCGCGCATGGATGGATCCGTCAGCGATAGCAATTGCCTCAGGTGATCCAAGTAATCACCATCAAGCTGCATTATCAATGTATCCATCAACAATTCCTGGCTATGGATTTGCCTCTGAAGTAGGCGGATTCTCTGGGTTTCGTATTCCTGCTCGAATCCAAGGTGAAGAAGAGGAGCACGATGGCATTTCCGATAAGCCATCCTCTGCTTCCTCTGATTCTCGCCATTGA
              
ATGGCAGAAACGTCAAGATTGGGTATAAGGAATACTGTAGGAGAGATTGTAGAAGTACAAGGAGGTCACATTGTGAGGTCTACGGGGCGGAAAGACCGCCACAGCAAGGTTTGCACAGCCAAAGGCCCCAGAGATCGCCGTGTGCGTCTCTCTGCTCATACTGCTATTCAGTTTTACGATGTGCAAGACCGCCTTGGTTATGATAGACCTAGTAAAGCTGTGGATTGGCTTATCAAAAAGGCAAAACCCGCCATTGATGAGCTAGCTGAGTTACCTGCCTGGAAACCTACAATTGGTACTGCATCTGCTGCTGCTGCTACTAACACCAATCTTGAACAGGAACAGGCTCAAAAACAGCAAGAAGATAACAACTTTGCATTTCAACAAGGAAATGTTAGTTTGTTTGATAATGTTGCTGGCCCTTCAAGTAAAAGAGCAATCGAAAGTAATACTGCTAGCTTTCTGCCTCCATCTTTAGAATCTGATGCTATTGCTGATACTATCAAATCTTTTTTCCCAATGGGTTCTTCAACCTCAGCTAACTCTTCAGCTATGCAGTTCCATAGCTTCCAAGAACCCCATATGTTATCAAGAGCCAATAGCCAGAACCAAGATTTGAGTCTCTCTTTACAGTTTCAAGATCCTATTTTGCTTCACCATCAAAACCAGCAAGCTCAACACCATAACCAAACTAACCATAGGGAACAAGAGCAAGTGCAGGGTCAAGCACCAGCCCACTTTGGAGGAAACACCCCACTTGGTTTTGACACCTCTGGCTGGTCTATGCATCAGAGACTTCGTTCTTGGAGTGACAGTAGAGAAATTGGCCCTGGTGGTAGTGGTGGAGCAGTAACAGGACCTGGTGGGTACTTGTTCAATTCGCCACCAGCACCGGCGCTGCTGCAGCAGCTATTCGGTCAAAATCAGTTTTTTTCTCAGAGGGGACCCCTTCAGTCCAGTAACACATCTTCGGTTCGCGCATGGATGGATCCGTCAGCGATAGCAATTGCCTCAGGTGATCCAAGTAATCACCATCAAGCTGCATTATCAATGTATCCATCAACAATTCCTGGCTATGGATTTGCCTCTGAAGTAGGCGGATTCTCTGGGTTTCGTATTCCTGCTCGAATCCAAGGTGAAGAAGAGGAGCACGATGGCATTTCCGATAAGCCATCCTCTGCTTCCTCTGATTCTCGCCATTGA
| Download sequence region | 
    Get flanking sequences on SL2.50ch07
     | 
	 mRNA Solyc07g062680.1.1
	 mRNA Solyc07g062680.1.1
 | 
	 Ontology terms
	 Ontology terms
 | terms associated with this mRNA | 
	 cDNA sequence
	 cDNA sequence
 | spliced cDNA sequence, including UTRs | 
       
    
  >Solyc07g062680.1.1 Transcription factor CYCLOIDEA (Fragment) (AHRD V1 *--* CYCLD_ANTML); contains Interpro domain(s)  IPR017887  Transcription factor TCP subgroup 
    
  
ATGGCAGAAACGTCAAGATTGGGTATAAGGAATACTGTAGGAGAGATTGTAGAAGTACAAGGAGGTCACATTGTGAGGTCTACGGGGCGGAAAGACCGCCACAGCAAGGTTTGCACAGCCAAAGGCCCCAGAGATCGCCGTGTGCGTCTCTCTGCTCATACTGCTATTCAGTTTTACGATGTGCAAGACCGCCTTGGTTATGATAGACCTAGTAAAGCTGTGGATTGGCTTATCAAAAAGGCAAAACCCGCCATTGATGAGCTAGCTGAGTTACCTGCCTGGAAACCTACAATTGGTACTGCATCTGCTGCTGCTGCTACTAACACCAATCTTGAACAGGAACAGGCTCAAAAACAGCAAGAAGATAACAACTTTGCATTTCAACAAGGAAATGTTAGTTTGTTTGATAATGTTGCTGGCCCTTCAAGTAAAAGAGCAATCGAAAGTAATACTGCTAGCTTTCTGCCTCCATCTTTAGAATCTGATGCTATTGCTGATACTATCAAATCTTTTTTCCCAATGGGTTCTTCAACCTCAGCTAACTCTTCAGCTATGCAGTTCCATAGCTTCCAAGAACCCCATATGTTATCAAGAGCCAATAGCCAGAACCAAGATTTGAGTCTCTCTTTACAGTTTCAAGATCCTATTTTGCTTCACCATCAAAACCAGCAAGCTCAACACCATAACCAAACTAACCATAGGGAACAAGAGCAAGTGCAGGGTCAAGCACCAGCCCACTTTGGAGGAAACACCCCACTTGGTTTTGACACCTCTGGCTGGTCTATGCATCAGAGACTTCGTTCTTGGAGTGACAGTAGAGAAATTGGCCCTGGTGGTAGTGGTGGAGCAGTAACAGGACCTGGTGGGTACTTGTTCAATTCGCCACCAGCACCGGCGCTGCTGCAGCAGCTATTCGGTCAAAATCAGTTTTTTTCTCAGAGGGGACCCCTTCAGTCCAGTAACACATCTTCGGTTCGCGCATGGATGGATCCGTCAGCGATAGCAATTGCCTCAGGTGATCCAAGTAATCACCATCAAGCTGCATTATCAATGTATCCATCAACAATTCCTGGCTATGGATTTGCCTCTGAAGTAGGCGGATTCTCTGGGTTTCGTATTCCTGCTCGAATCCAAGGTGAAGAAGAGGAGCACGATGGCATTTCCGATAAGCCATCCTCTGCTTCCTCTGATTCTCGCCATTGA
     
    
ATGGCAGAAACGTCAAGATTGGGTATAAGGAATACTGTAGGAGAGATTGTAGAAGTACAAGGAGGTCACATTGTGAGGTCTACGGGGCGGAAAGACCGCCACAGCAAGGTTTGCACAGCCAAAGGCCCCAGAGATCGCCGTGTGCGTCTCTCTGCTCATACTGCTATTCAGTTTTACGATGTGCAAGACCGCCTTGGTTATGATAGACCTAGTAAAGCTGTGGATTGGCTTATCAAAAAGGCAAAACCCGCCATTGATGAGCTAGCTGAGTTACCTGCCTGGAAACCTACAATTGGTACTGCATCTGCTGCTGCTGCTACTAACACCAATCTTGAACAGGAACAGGCTCAAAAACAGCAAGAAGATAACAACTTTGCATTTCAACAAGGAAATGTTAGTTTGTTTGATAATGTTGCTGGCCCTTCAAGTAAAAGAGCAATCGAAAGTAATACTGCTAGCTTTCTGCCTCCATCTTTAGAATCTGATGCTATTGCTGATACTATCAAATCTTTTTTCCCAATGGGTTCTTCAACCTCAGCTAACTCTTCAGCTATGCAGTTCCATAGCTTCCAAGAACCCCATATGTTATCAAGAGCCAATAGCCAGAACCAAGATTTGAGTCTCTCTTTACAGTTTCAAGATCCTATTTTGCTTCACCATCAAAACCAGCAAGCTCAACACCATAACCAAACTAACCATAGGGAACAAGAGCAAGTGCAGGGTCAAGCACCAGCCCACTTTGGAGGAAACACCCCACTTGGTTTTGACACCTCTGGCTGGTCTATGCATCAGAGACTTCGTTCTTGGAGTGACAGTAGAGAAATTGGCCCTGGTGGTAGTGGTGGAGCAGTAACAGGACCTGGTGGGTACTTGTTCAATTCGCCACCAGCACCGGCGCTGCTGCAGCAGCTATTCGGTCAAAATCAGTTTTTTTCTCAGAGGGGACCCCTTCAGTCCAGTAACACATCTTCGGTTCGCGCATGGATGGATCCGTCAGCGATAGCAATTGCCTCAGGTGATCCAAGTAATCACCATCAAGCTGCATTATCAATGTATCCATCAACAATTCCTGGCTATGGATTTGCCTCTGAAGTAGGCGGATTCTCTGGGTTTCGTATTCCTGCTCGAATCCAAGGTGAAGAAGAGGAGCACGATGGCATTTCCGATAAGCCATCCTCTGCTTCCTCTGATTCTCGCCATTGA
	 Protein sequence
	 Protein sequence
 | translated polypeptide sequence | 
       
    
  >Solyc07g062680.1.1 Transcription factor CYCLOIDEA (Fragment) (AHRD V1 *--* CYCLD_ANTML); contains Interpro domain(s)  IPR017887  Transcription factor TCP subgroup 
    
  
MAETSRLGIRNTVGEIVEVQGGHIVRSTGRKDRHSKVCTAKGPRDRRVRLSAHTAIQFYDVQDRLGYDRPSKAVDWLIKKAKPAIDELAELPAWKPTIGTASAAAATNTNLEQEQAQKQQEDNNFAFQQGNVSLFDNVAGPSSKRAIESNTASFLPPSLESDAIADTIKSFFPMGSSTSANSSAMQFHSFQEPHMLSRANSQNQDLSLSLQFQDPILLHHQNQQAQHHNQTNHREQEQVQGQAPAHFGGNTPLGFDTSGWSMHQRLRSWSDSREIGPGGSGGAVTGPGGYLFNSPPAPALLQQLFGQNQFFSQRGPLQSSNTSSVRAWMDPSAIAIASGDPSNHHQAALSMYPSTIPGYGFASEVGGFSGFRIPARIQGEEEEHDGISDKPSSASSDSRH*
    
MAETSRLGIRNTVGEIVEVQGGHIVRSTGRKDRHSKVCTAKGPRDRRVRLSAHTAIQFYDVQDRLGYDRPSKAVDWLIKKAKPAIDELAELPAWKPTIGTASAAAATNTNLEQEQAQKQQEDNNFAFQQGNVSLFDNVAGPSSKRAIESNTASFLPPSLESDAIADTIKSFFPMGSSTSANSSAMQFHSFQEPHMLSRANSQNQDLSLSLQFQDPILLHHQNQQAQHHNQTNHREQEQVQGQAPAHFGGNTPLGFDTSGWSMHQRLRSWSDSREIGPGGSGGAVTGPGGYLFNSPPAPALLQQLFGQNQFFSQRGPLQSSNTSSVRAWMDPSAIAIASGDPSNHHQAALSMYPSTIPGYGFASEVGGFSGFRIPARIQGEEEEHDGISDKPSSASSDSRH*
	 Gene model matches
	 Gene model matches
 | 
	 SGN Unigenes
	 SGN Unigenes
 | [Associate new unigene] | 
    Unigene ID:
    
    
  
[loading...]
  
	 GenBank accessions
	 GenBank accessions
 | [Associate new genbank sequence] | 
| Other genome matches | None | 
	 Literature annotations [5]
	 Literature annotations [5]
 | [Associate publication] [Matching publications] | 
    Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato.   
    Nature genetics (2007) 
  
Show / hide abstract
    
  Show / hide abstract
       Plant leaves show pronounced plasticity of size and form. In the classical, partially dominant mutation Lanceolate (La), the large compound leaves of tomato (Solanum lycopersicum) are converted into small simple ones. We show that LA encodes a transcription factor from the TCP family containing an miR319-binding site. Five independent La isolates are gain-of-function alleles that result from point mutations within the miR319-binding site and confer partial resistance of the La transcripts to microRNA (miRNA)-directed inhibition. The reduced sensitivity to miRNA regulation leads to elevated LA expression in very young La leaf primordia and to precocious differentiation of leaf margins. In contrast, downregulation of several LA-like genes using ectopic expression of miR319 resulted in larger leaflets and continuous growth of leaf margins. Our results imply that regulation of LA by miR319 defines a flexible window of morphogenetic competence along the developing leaf margin that is required for leaf elaboration.
    
     
       Ori, N. Cohen, AR. Etzioni, A. Brand, A. Yanai, O. Shleizer, S. Menda, N. Amsellem, Z. Efroni, I. Pekker, I. Alvarez, JP. Blum, E. Zamir, D. Eshed, Y.
       Nature genetics.
       2007.
        39(6).
       787-91.
      
  
    The NAC-domain transcription factor GOBLET specifies leaflet boundaries in compound tomato leaves.   
    Development (Cambridge, England) (2009) 
  
Show / hide abstract
    
  Show / hide abstract
       Leaves are formed at the flanks of the shoot apical meristem (SAM) and develop into a variety of forms. In tomato, prolonged leaf patterning enables the elaboration of compound leaves by reiterative initiation of leaflets with lobed margins. In goblet (gob) loss-of-function mutants, primary leaflets are often fused, secondary leaflets and marginal serrations are absent, and SAMs often terminate precociously. We show that GOB encodes a NAC-domain transcription factor expressed in narrow stripes at the leaf margins, flanking the distal side of future leaflet primordia, and at the boundaries between the SAM and leaf primordia. Leaf-specific overexpression of the microRNA miR164, a negative regulator of GOB-like genes, also leads to loss of secondary-leaflet initiation and to smooth leaflet margins. Plants carrying a dominant gob allele with an intact ORF but disrupted miR164 binding site produce more cotyledons and floral organs, have split SAMs and, surprisingly, simpler leaves. Overexpression of a form of GOB with an altered miR164 binding site in leaf primordia leads to delayed leaflet maturation, frequent, improperly timed and spaced initiation events, and a simple mature leaflet form owing to secondary-leaflet fusion. miR164 also affects leaflet separation in Cardamine hirsuta, a Brassicaceae species with complex leaves. Genetic and molecular analyses suggest that GOB expression is intact in the simplified leaves of entire tomato mutants, which have a defect in a putative repressor of auxin responses. Our results show that GOB marks leaflet boundaries and that its accurate spatial, temporal and quantitative activity affects leaf elaboration in a context-dependent manner.
    
     
       Berger, Y. Harpaz-Saad, S. Brand, A. Melnik, H. Sirding, N. Alvarez, JP. Zinder, M. Samach, A. Eshed, Y. Ori, N.
       Development (Cambridge, England).
       2009.
        136(5).
       823-32.
      
  
    Gibberellin partly mediates LANCEOLATE activity in tomato.   
    The Plant journal : for cell and molecular biology (2011) 
  
Show / hide abstract
    
  Show / hide abstract
       Elaboration of a compound leaf shape depends on extended morphogenetic activity in developing leaves. In tomato (Solanum lycopersicum), the CIN-TCP transcription factor LANCEOLATE (LA) promotes leaf differentiation. LA is negatively regulated by miR319 during the early stages of leaf development, and decreased sensitivity of LA mRNA to miR319 recognition in the semi-dominant mutant La leads to prematurely increased LA expression, precocious leaf differentiation and a simpler and smaller leaf. Increased levels or responses of the plant hormone gibberellin (GA) in tomato leaves also led to a simplified leaf form. Here, we show that LA activity is mediated in part by GA. Expression of the SlGA20 oxidase1 (SlGA20ox1) gene, which encodes an enzyme in the GA biosynthesis pathway, is increased in gain-of-function La mutants and reduced in plants that over-express miR319. Conversely, the transcript levels of the GA deactivation gene SlGA2 oxidase4 (SlGA2ox4) are increased in plants over-expressing miR319. The miR319 over-expression phenotype is suppressed by exogenous GA application and by a mutation in the PROCERA (PRO) gene, which encodes an inhibitor of the GA response. SlGA2ox4 is expressed in initiating leaflets during early leaf development. Its expression expands as a result of miR319 over-expression, and its over-expression leads to increased leaf complexity. These results suggest that LA activity is partly mediated by positive regulation of the GA response, probably by regulation of GA levels.
    
     
       Yanai, O. Shani, E. Russ, D. Ori, N.
       The Plant journal : for cell and molecular biology.
       2011.
        68(4).
       571-82.
      
  
    Auxin and LANCEOLATE affect leaf shape in tomato via different developmental processes.   
    Plant signaling & behavior (2012) 
  
Show / hide abstract
    
  Show / hide abstract
       Elaboration of a complex leaves depends on the morphogenetic activity of a specific tissue at the leaf margin termed marginal-blastozon (MB). In tomato (Solanum lycopersicym), prolonged activity of the MB leads to the development of compound leaves. The activity of the MB is restricted by the TCP transcription factor LANCEOLATE (LA). Plants harboring the dominant LA mutant allele La-2 have simple leaves with a uniform blade. Conversely, leaves of pFIL > > miR319 are compound and grow indeterminately in their margins due to leaf overexpression of miR319, a negative regulator of LA and additional miR319-sensitive genes. We have recently shown that the auxin-response sensor DR5::VENUS marks and precedes leaflet initiation events in the MB. Mutations in ENTIRE (E), an auxin signal inhibitor from the Aux/IAA family, lead to the expansion of the DR5::VENUS signal to throughout the leaf-primordia margin, and to a simplified leaf phenotype. Here, we examined the interaction between auxin, E, and LA in tomato leaf development. In La-2 leaf primordia, the auxin signal is very weak and is diffused to throughout the leaf margin, suggesting that auxin acts within the developmental-context of MB activity, which is controlled by LA. e La-2 double mutants showed an enhanced simple leaf phenotype and e pFIL > > miR319 leaves initiated less leaflets than wild-type, but their margins showed continuous growth. These results suggest that E and auxin affect leaflet initiation within the context of the extended MB activity, but their influence on the extent of indeterminate growth of the leaf is minor.
    
     
       Ben-Gera, H. Ori, N.
       Plant signaling & behavior.
       2012.
        7(10).
       .
      
  
    Identification, cloning and characterization of the tomato TCP transcription factor family.   
    BMC plant biology (2014) 
  
Show / hide abstract
    
  Show / hide abstract
       The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development.
    
     
       Parapunova, V. Busscher, M. Busscher-Lange, J. Lammers, M. Karlova, R. Bovy, AG. Angenent, GC. de Maagd, RA.
       BMC plant biology.
       2014.
        14().
       157.
      
  	 Ontology annotations (14)
	 Ontology annotations (14)
 | [Add ontology annotations] | 
[loading...] 
	 Related views
	 Related views
 | 
- Genomic details
 
| User comments | 
Please wait, checking for comments.  (If comments do not show up, access them here)
Your Lists
Public Lists
List Contents
List Validation Report: Failed
Elements not found:
Optional: Add Missing Accessions to A List
Mismatched case
            Click the Adjust Case button to align the case in the list with what is in the database.
          
          Multiple mismatched case
Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.
List elements matching a synonym
Multiple synonym matches
Fuzzy Search Results
Synonym Search Results
Available Seedlots
Your Datasets
Public Datasets
Dataset Contents
Dataset Validation Failed
Elements not found:
Your Calendar
Having trouble viewing events on the calendar? 
Are you associated with the breeding program you are interested in viewing?
Add New Event
Event Info
| Attribute | Value | 
|---|---|
| Project Name: | |
| Start Date: | |
| End Date: | |
| Event Type: | |
| Event Description: | |
| Event Web URL: | 
Edit Event
Login
Forgot Username
                    If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.
                
                Reset Password
                    To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.
                
                Create New User
Working
    	      
	        
Links to external databases
Links to external databases
