Cloning Vector – pSMART-BAC v2.0

Sequence7,648 bases 
>pSMART-BAC v2.0
CCACCACAGTGGGATCCGAAGCTTGGAATTCACGTGACTTGAAGTCGCGGCCGCACTGACCCTATAGTGAGTCGTATTAATTTAAATCATACCAACAT
GGTCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAATCTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGA
TCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATC
CCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGA
CCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTTCGTATGGCAATGAAAGAC
GGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGA
TTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCG
TCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTAT
ACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACA
GTACTGCGATGAGTGGCAGGGCGGGGCGTAACCTAGGTGACAGAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGCTAGATCGGCCGCATCG
AATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGCGATGAGCTCGGACTTCCATTGTTCATTCCACGGACAAAAACAGAGAAAGGAAACGAC
AGAGGCCAAAAAGCTCGCTTTCAGCACCTGTCGTTTCCTTTCTTTTCAGAGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAAC
GCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCCGCGAGGTCGCCGCCCCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGA
TTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTA
ACGTAAAAGCAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCCGAGCTCGCGAGCTCGTCGACAGCGACACACTTGCAT
CGGATGCAGCCCGGTTAACGTGCCGGCACGGCCTGGGTAACCAGGTATTTTGTCCACATAACCGTGCGCAAAATGTTGTGGATAAGCAGGACACAGCA
GCAATCCACAGCAGGCATACAACCGCACACCGAGGTTACTCCGTTCTACAGGTTACGACGACCATGTCAATACTTGCCCTTGACAGGCATTGATGGAA
TCGTAGTCTCACGCTGATAGTCTGATCGACAATACAAGTGGGACCGTGGTCCCAGACCGATAATCAGACCGACAACACGAGTGGGATCGTGGTCCCAG
ACTAATAATCAGACCGACGATACGAGTGGGACCGTGGTCCCAGACTAATAATCAGACCGACGATACGAGTGGGACCGTGGTTCCAGACTAATAATCAG
ACCGACGATACGAGTGGGACCGTGGTCCCAGACTAATAATCAGACCGACGATACGAGTGGGACCATGGTCCCAGACTAATAATCAGACCGACGATACG
AGTGGGACCGTGGTCCCAGTCTGATTATCAGACCGACGATACGAGTGGGACCGTGGTCCCAGACTAATAATCAGACCGACGATACGAGTGGGACCGTG
GTCCCAGACTAATAATCAGACCGACGATACGAGTGGGACCGTGGTCCCAGTCTGATTATCAGACCGACGATACAAGTGGAACAGTGGGCCCAGAGAGA
ATATTCAGGCCAGTTATGCTTTCTGGCCTGTAACAAAGGACATTAAGTAAAGACAGATAAACGTAGACTAAAACGTGGTCGCATCAGGGTGCTGGCTT
TTCAAGTTCCTTAAGAATGGCCTCAATTTTCTCTATACACTCAGTTGGAACACGAGACCTGTCCAGGTTAAGCACCATTTTATCGCCCTTATACAATA
CTGTCGCTCCAGGAGCAAACTGATGTCGTGAGCTTAAACTAGTTCTTGATGCAGATGACGTTTTAAGCACAGAAGTTAAAAGAGTGATAACTTCTTCA
GCTTCAAATATCACCCCAGCTTTTTTCTGCTCATGAAGGTTAGATGCCTGCTGCTTAAGTAATTCCTCTTTATCTGTAAAGGCTTTTTGAAGTGCATC
ACCTGACCGGGCAGATAGTTCACCGGGGTGAGAAAAAAGAGCAACAACTGATTTAGGCAATTTGGCGGTGTTGATACAGCGGGTAATAATCTTACGTG
AAATATTTTCCGCATCAGCCAGCGCAGAAATATTTCCAGCAAATTCATTCTGCAATCGGCTTGCATAACGCTGACCACGTTCATAAGCACTTGTTGGG
CGATAATCGTTACCCAATCTGGATAATGCAGCCATCTGCTCATCATCCAGCTCGCCAACCAGAACACGATAATCACTTTCGGTAAGTGCAGCAGCTTT
ACGACGGCGACTCCCATCGGCAATTTCTATGACACCAGATACTCTTCGACCGAACGCCGGTGTCTGTTGACCAGTCAGTAGAAAAGAAGGGATGAGAT
CATCCAGTGCGTCCTCAGTAAGCAGCTCCTGGTCACGTTCATTACCTGACCATACCCGAGAGGTCTTCTCAACACTATCACCCCGGAGCACTTCAAGA
GTAAACTTCACATCCCGACCACATACAGGCAAAGTAATGGCATTACCGCGAGCCATTACTCCTACGCGCGCAATTAACGAATCCACCATCGGGGCAGC
TGGTGTCGATAACGAAGTATCTTCAACCGGTTGAGTATTGAGCGTATGTTTTGGAATAACAGGCGCACGCTTCATTATCTAATCTCCCAGCGTGGTTT
AATCAGACGATCGAAAATTTCATTGCAGACAGGTTCCCAAATAGAAAGAGCATTTCTCCAGGCACCAGTTGAAGAGCGTTGATCAATGGCCTGTTCAA
AAACAGTTCTCATCCGGATCTGACCTTTACCAACTTCATCCGTTTCACGTACAACATTTTTTAGAACCATGCTTCCCCAGGCATCCCGAATTTGCTCC
TCCATCCACGGGGACTGAGAGCCATTACTATTGCTGTATTTGGTAAGCAAAATACGTACATCAGGCTCGAACCCTTTAAGATCAACGTTCTTGAGCAG
ATCACGAAGCATATCGAAAAACTGCAGTGCGGAGGTGTAGTCAAACAACTCAGCAGGCGTGGGAACAATCAGCACATCAGCAGCACATACGACATTAA
TCGTGCCGATACCCAGGTTAGGCGCGCTGTCAATAACTATGACATCATAGTCATGAGCAACAGTTTCAATGGCCAGTCGGAGCATCAGGTGTGGATCG
GTGGGCAGTTTACCTTCATCAAATTTGCCCATTAACTCAGTTTCAATACGGTGCAGAGCCAGACAGGAAGGAATAATGTCAAGCCCCGGCCAGCAAGT
GGGCTTTATTGCATAAGTGACATCGTCCTTTTCCCCAAGATAGAAAGGCAGGAGAGTGTCTTCTGCATGAATATGAAGATCTGGTACCCATCCGTGAT
ACATTGAGGCTGTTCCCTGGGGGTCGTTACCTTCCACGAGCAAAACACGTAGCCCCTTCAGAGCCAGATCCTGAGCAAGATGAACAGAAACTGAGGTT
TTGTAAACGCCTCCTTTATGGGCAGCAACCCCGATCACCGGTGGAAATACGTCTTCAGCACGTCGCAATCGCGTACCAAACACATCACGCATATGATT
AATTTGTTCAATTGTATAACCAACACGTTGCTCAACCCGTCCTCGAATTTCCATATCCGGGTGCGGTAGTCGCCCTGCTTTCTCGGCATCTCTGATAG
CCTGAGAAGAAACCCCAACTAAATCCGCTGCTTCACCTATTCTCCAGCGCCGGGTTATTTTCCTCGCTTCCGGGCTGTCATCATTAAACTGTGCAATG
GCGATAGCCTTCGTCATTTCATGACCAGCGTTTATGCACTGGTTAAGTGTTTCCATGAGTTTCATTCTGAACATCCTTTAATCATTGCTTTGCGTTTT
TTTATTAAATCTTGCAATTTACTGCAAAGCAACAACAAAATCGCAAAGTCATCAAAAAACCGCAAAGTTGTTTAAAATAAGAGCAACACTACAAAAGG
AGATAAGAAGAGCACATACCTCAGTCACTTATTATCACTAGCGCTCGCCGCAGCCGTGTAACCGAGCATAGCGAGCGAACTGGCGAGGAAGCAAAGAA
GAACTGTTCTGTCAGATAGCTCTTACGCTCAGCGCAAGAAGAAATATCCACCGTGGGAAAAACTCCAGGTAGAGGTACACACGCGGATAGCCAATTCA
GAGTAATAAACTGTGATAATCAACCCTCATCAATGATGACGAACTAACCCCCGATATCAGGTCACATGACGAAGGGAAAGAGAAGGAAATCAACTGTG
ACAAACTGCCCTCAAATTTGGCTTCCTTAAAAATTACAGTTCAAAAAGTATGAGAAAATCCATGCAGGCTGAAGGAAACAGCAAAACTGTGACAAATT
ACCCTCAGTAGGTCAGAACAAATGTGACGAACCACCCTCAAATCTGTGACAGATAACCCTCAGACTATCCTGTCGTCATGGAAGTGATATCGCGGAAG
GAAAATACGATATGAGTCGTCTGGCGGCCTTTCTTTTTCTCAATGTATGAGAGGCGCATTGGAGTTCTGCTGTTGATCTCATTAACACAGACCTGCAG
GAAGCGGCGGCGGAAGTCAGGCATACGCTGGTAACTTTGAGGCAGCTGGTAACGCTCTATGATCCAGTCGATTTTCAGAGAGACGATGCCTGAGCCAT
CCGGCTTACGATACTGACACAGGGATTCGTATAAACGCATGGCATACGGATTGGTGATTTCTTTTGTTTCACTAAGCCGAAACTGCGTAAACCGGTTC
TGTAACCCGATAAAGAAGGGAATGAGATATGGGTTGATATGTACACTGTAAAGCCCTCTGGATGGACTGTGCGCACGTTTGATAAACCAAGGAAAAGA
TTCATAGCCTTTTTCATCGCCGGCATCCTCTTCAGGGCGATAAAAAACCACTTCCTTCCCCGCGAAACTCTTCAATGCCTGCCGTATATCCTTACTGG
CTTCCGCAGAGGTCAATCCGAATATTTCAGCATATTTAGCAACATGGATCTCGCAGATACCGTCATGTTCCTGTAGGGTGCCATCAGATTTTCTGATC
TGGTCAACGAACAGATACAGCATACGTTTTTGATCCCGGGAGAGACTATATGCCGCCTCAGTGAGGTCGTTTGACTGGACGATTCGCGGGCTATTTTT
ACGTTTCTTGTGATTGATAACCGCTGTTTCCGCCATGACAGATCCATGTGAAGTGTGACAAGTTTTTAGATTGTCACACTAAATAAAAAAGAGTCAAT
AAGCAGGGATAACTTTGTGAAAAAACAGCTTCTTCTGAGGGCAATTTGTCACAGGGTTAAGGGCAATTTGTCACAGACAGGACTGTCATTTGAGGGTG
ATTTGTCACACTGAAAGGGCAATTTGTCACAACACCTTCTCTAGAACCAGCATGGATAAAGGCCTACAAGGCGCTCTAAAAAAGAAGATCTAAAAACT
ATAAAAAAAATAATTATAAAAATATCCCCGTGGATAAGTGGATAACCCCAAGGGAAGTTTTTTCAGGCATCGTGTGTAAGCAGAATATATAAGTGCTG
TTCCCTGGTGCTTCCTCGCTCACTCGACCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGCGCAGCCCTGG
TTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTT
TCTGCCTGTGGACAGCCCCTCAAATGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAG
TAGTCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACTCGCGTAAAATCAGGCGTTTTCGCCG
ATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAAC
GTCCGCCCCTCATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGGCCGCGGTGTCTCGCACACGGCTTCGACGGCGTT
TCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAGCCGAGGGCTTCGCCCTGTCGCTCGACTGCGGCGAGCACTACT
GGCTGTAAAAGGACAGACCACATCATGGTTCTGTGTTCATTAGGTTGTTCTGTCCATTGCTGACATAATCCGCTCCACTTCAACGTAACACCGCACGA
AGATTTCTATTGTTCCTGAAGGCATATTCAAATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATAAACGCTACACAGGCTC
CTGAGATTAATAATGCGGATCTCTACGATAATGGGAGATTTTCCCGACTGTTTCGTTCGCTTCTCAGTGGATAACAGCCAGCTTCTCTGTTTAACAGA
CAAAAACAGCATATCCACTCAGTTCCACATTTCCATATAAAGGCCAAGGCATTTATTCTCAGGATAATTGTTTCAGCATCGCAACCGCATCAGACTCC
GGCATCGCAAACTGCACCCGGTGCCGGGCAGCCACATCCAGCGCAAAAACCTTCGTGTAGACTTCCGTTGAACTGATGGACTTATGTCCCATCAGGCT
TTGCAGAACTTTCAGCGGTATACCGGCATACAGCATGTGCATCGCATAGGAATGGCGGAACGTATGTGGTGTGACCGGAACAGAGAACGTCACACCGT
CAGCAGCAGCGGCGGCAACCGCCTCCCCAATCCAGGTCCTGACCGTTCTGTCCGTCACTTCCCAGATCCGCGCTTTCTCTGTCCTTCCTGTGCGACGG
TTACGCCGCTCCATGAGCTTATCGGGTCCACTCGCGAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGATTACATTTGCGGCCTAACTGTGGCC
AGTCCAGTTACGCTGGAGTCACTAGTATTTAGGTGACACTATAGAAGCGGCCGCGACAACTTGTCCACGTGGAATTCTAAGCTTAGGATCCCAATGTG
ATGG