SGN Marker SSR331

SGN-M1004

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 55
Repeat motif: CGG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CGCCTATCGATACCACCACT
Reverse primer: ATTGATCCGTTTGGTTCTGC
Predicted size: 178
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39226)
Chromosome
2
Position
78.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14087
Forward primer (5'-3')
CGCCTATCGATACCACCACT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTGATCCGTTTGGTTCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 173+178
Solanum lycopersicum LA925: 178+179
Approximate temperature
55°C
  
Genomic location of SSR331  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1004 marker 1004
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)