SGN Marker TG301

SGN-M109

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG301 image not available
Forward sequence
TTGTAACTTACTAAATTAAGAGCTCAGGATGAACAGAACACGAATTATTAGTTCATATTAAGCAAGAAACTTAAAAAACTTCACCTTCTC
CAACATACTCTACAACAAACTCTTTTGTCTTGATATCTTCATCTGCCACAATCCCAGTGCCACATTTCTCAGTCTGCACGTTATGAGTCA
ACAAAACTTTAGTTTTTTAGATGATTATTGCTTGGTTTTCAAAAGAAACGAAAATAAGAAGAATACAAAATAACCAACATTTCTTTACTT
CTTCACCAGATACACAACTGAATTAAATGCAAAAATAGATATGAAAAATGTTACCAGCCTGCACTTTTGATGCAGATTGTACTTGTTTGC
AATTGAAAAGTGTCGAATGGTCATTTTTGGTAAAAACTGATGAATGTGGTATTTTGAGAAAGGATTTATGACGGTCCTTTTGCTTAATTA
TCCCTCTTATAAACGTTAGTAAAGGC
Reverse sequence
TATTCTGAATCTGGAAAATTGTTCTGCCAATTTCTTTGACCAACCAGACAATACCCTTTTAATCTAAGACCCTAATTACAAGGTTACTGA
CAATCACTTTTGACACCAATGTCTTTGATAAAGCACTGTTAAAATTTTCAGATGTGCTTTAATACTCTGCATCCTTTTTAGGAACTCTTT
TGTCTACTTTCACTTTTTAAAAGAAAGAACTTAAGGAGAGGACATACTTATTATTTTTGCATTTTCTATATCAAGTAAAGTGAGAAGACT
TCCATTAATTTGCATCCAGCGGATGCTAATGGCTACAACATAGCTACTTTAAGCAAATAGGTGATTTGATCAAGATTCTTTACGTTTTCA
AGATCACAGCAACAAAAAGGGTTCCTTAAAAACCTAGCCTTTACTAACGTTTATAAGAGGGATAATTAAGCAAAAGGACCGTCATAAATC
CTTTCTCAAAATACCACATTCATCAGTTTTTACCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1500143.2e-3981 (17.0% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53535)
Chromosome
1
Position
0.04 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53260)
Chromosome
1
Position
28.19 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42436)
Chromosome
1
Position
15.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39986)
Chromosome
1
Position
9.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8126)
Chromosome
1
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8128)
Chromosome
1
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8127)
Chromosome
1
Position
5.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8132)
Chromosome
1
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8131)
Chromosome
1
Position
5.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35629
Forward primer (5'-3')
AGCTCAGGATGAACAGAACACGAA
Digested band sizes (using AseI)
Solanum pennellii LA716: 150+550
Solanum lycopersicum LA925: 150+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTTTTGACACCAATGTCTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG301 was used as an overgo probe on plate 3 [well A7]

Plausible BAC Matches:   P124N23,   P034F21,   P165H20

 Overgo Sequences

A sequence
ATCCCAGTGCCACATTTCTCAGTC
B sequence
TGACTCATAACGTGCAGACTGAGA
AB sequence
ATCCCAGTGCCACATTTCTCAGTCTGCACG
Marker sequence
TTGTAACTTACTAAATTAAGAGCTCAGGATGAACAGAACACGAATTATTA
GTTCATATTAAGCAAGAAACTTAAAAAACTTCACCTTCTCCAACATACTC
TACAACAAACTCTTTTGTCTTGATATCTTCATCTGCCACAATCCCAGTGC
CACATTTCTCAGTCTGCACGTTATGAGTCAACAAAACTTTAGTTTTTTAG
ATGATTATTGCTTGGTTTTCAAAAGAAACGAAAATAAGAAGAATACAAAA
TAACCAACATTTCTTTACTTCTTCACCAGATACACAACTGAATTAAATGC
AAAAATAGATATGAAAAATGTTACCAGCCTGCACTTTTGATGCAGATTGT
ACTTGTTTGCAATTGAAAAGTGTCGAATGGTCATTTTTGGTAAAAACTGA
TGAATGTGGTATTTTGAGAAAGGATTTATGACGGTCCTTTTGCTTAATTA
TCCCTCTTATAAACGTTAGTAAAGGC
Genomic location of TG301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D109 marker 109
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)