SGN Marker CT205

SGN-M110

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
CTTTTTTTTTTTTTTTAAAAATTGAAGGGAGAATCTTGTTTGCTCAAATAAAAGCTCCAAAGTTCTTGATAACTTCAAATGCAAGGTAAT
TAAAAAGCATAATGGATGATTCTCCTTGTCAAAGTTAAACTAACTTCAGGGGGTCATTTGTTCACTTCTTCCTCTTCTTTGGAGGCTGGA
TAGCTTCTTCTTCTTCATCCTCTTCATCATCATCTTCTGGATCGTCGTCCTCTACGACTTCTTCTTCACCCTCTCCTTCTTCAGCTTCTT
CATCATCATCATTATCATCGTCGCCATCATCGTCGTCGTCACCGTCATCATCATGACCTTCTTCACCAACATCCTCTTCATCTTCTGCAT
CTCCGTTCTCCTCACCTTCTCCATTGCTTTTCTTGGCATTTCCTTTGCTTTTGTTTCCATGAACCCCTTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1497782e-0967 (15.6% of RFLP seq)-
SGN-U1491453.5e-54106 (24.7% of RFLP seq)-
SGN-U1491451e-140255 (59.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53459)
Chromosome
2
Position
10.22 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43644)
Chromosome
2
Position
31.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43504)
Chromosome
2
Position
10.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43044)
Chromosome
2
Position
22.50 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40747)
Chromosome
2
Position
17.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39013)
Chromosome
2
Position
13.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39014)
Chromosome
5
Position
47.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8133)
Chromosome
2
Position
16.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8138)
Chromosome
2
Position
14.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT205 was used as an overgo probe on plate 15 [well F10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTTCTGGATCGTCGTCCTCTAC
B sequence
GGGTGAAGAAGAAGTCGTAGAGGA
AB sequence
ATCTTCTGGATCGTCGTCCTCTACGACTTC
Marker sequence
CTTTTTTTTTTTTTTTAAAAATTGAAGGGAGAATCTTGTTTGCTCAAATA
AAAGCTCCAAAGTTCTTGATAACTTCAAATGCAAGGTAATTAAAAAGCAT
AATGGATGATTCTCCTTGTCAAAGTTAAACTAACTTCAGGGGGTCATTTG
TTCACTTCTTCCTCTTCTTTGGAGGCTGGATAGCTTCTTCTTCTTCATCC
TCTTCATCATCATCTTCTGGATCGTCGTCCTCTACGACTTCTTCTTCACC
CTCTCCTTCTTCAGCTTCTTCATCATCATCATTATCATCGTCGCCATCAT
CGTCGTCGTCACCGTCATCATCATGACCTTCTTCACCAACATCCTCTTCA
TCTTCTGCATCTCCGTTCTCCTCACCTTCTCCATTGCTTTTCTTGGCATT
TCCTTTGCTTTTGTTTCCATGAACCCCTTC
Genomic location of CT205  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D110 marker 110
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)