SGN Marker SSR578

SGN-M1251

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 50
Repeat motif: AAC   Repeat number: 6
Repeat motif: ATC   Repeat number: 5
Repeat motif:    Repeat number:
Forward primer: ATTCCCAGCACAACCAGACT
Reverse primer: GTTGGTGGATGAAATTTGTG
Predicted size: 296
Derivations 
This marker was derived from EST read SGN-E156942
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52843)
Chromosome
6
Position
24.89 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39265)
Chromosome
6
Position
44.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14118
Forward primer (5'-3')
ATTCCCAGCACAACCAGACT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GTTGGTGGATGAAATTTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 296+294
Solanum pimpinellifolium LA1589: 296+291
Approximate temperature
55°C
  
PCR data   Exp. ID 81
Forward primer (5'-3')
ATTCCCAGCACAACCAGACT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTTGGTGGATGAAATTTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 294+294
Solanum pennellii LA716: 294+289
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR578 was used as an overgo probe on plate 14 [well B1]

Plausible BAC Matches:   P224I22,   P270I07,   P174F14,   P237F15,   P270L24,   P174L13,   P026P19,   P268A21,   P150J13,   P272J24,   P326H01,   P094E11,   P037A05,   P281F07,   P217P10,   P068J14,   P208J23,   P190C12,   P127C13,   P268K19,   P128G13,   P233I23,   P074K20,   P043B24,   P042A17,   P273A01,   P069P07,   P026C23,   P125J22,   P109J05,   P143H24,   P144D21,   P080E24,   P202N18,   P089F15,   P333A15,   P042G19,   P262C13,   P126O23,   P019G01,   P208N16,   P070H04,   P202M18,   P192B10,   P120C03,   P262N02,   P169P10,   P333H17,   P261P16,   P315P12,   P163P02,   P271A14,   P268I23,   P138D24,   P142F07,   P260B04,   P186E13,   P032J05,   P312P01,   P285I11,   P080F24,   P257A03,   P222P15,   P058N11,   P083M16,   P223P20,   P047A14,   P079E24,   P236I17,   P109P10,   P311O03,   P252M14,   P221C23,   P173B24,   P293N05,   P276B18,   P242M07

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CAAAACCCTCTTCCTCTTCCTCTT
B sequence
GATGATGAGAAAGAGGAAGAGGAA
AB sequence
CAAAACCCTCTTCCTCTTCCTCTTCCTCTT
Marker sequence
GCACAAAGATAACATAAGTTACTAGTAAGCGCAGCGCGCTAGCGCAAAGA
AAGAGAAGAAGTATATACATGGAGCTATTCCCAGCACAACCAGACTTATC
TTTACAAATAAGTCCTCCAAACAACAAATCATCATCATCATCAACAACAA
CAACAACAACATGGAAGGCTATGAGTAGTAATAATAACAATATTGATAGA
GATGAGATGGACTTATTCTTCTTGAGAAGAGCTTTAGAATCAAAACCTGA
TAACAACAATACTCTTTTTGAGCTTTCTTTATCTAATCCTAATTATAAAC
CTTCTCATCATACTCAACTAATTAACTCTTCCCATTTTCATCCCCTACAA
AACACAAATTTCATCCACCAACAAAATCAACAACAACTTAATATCATGAG
ACCTATAAGAGGAATTCCATTGTACAATCAAAACCCTCTTCCTCTTCCTC
TTCCTCTTTCTCATCATCATAATAACTACCCAATATTTGCTCACCAAACC
TTTGAAAATACTGCTCCTACAACAACACCTACATTACCTATACATTCTTC
TGGATATTGTATTAGTAGTTTTAGTAACAATAGTAACAAAACTATACCTA
ATTCCTCACCAACAACTATCCCTTTTCATCATTCTAATCATCAAAGTGGG
CTAATGCGATCTAGA
Genomic location of SSR578  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1251 marker 1251
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)