SGN Marker SSR602

SGN-M1275

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 44
Repeat motif: AAG   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: GGGTCACATACACTCATACTAAGGA
Reverse primer: GGCAATCATAGCCACTTGGT
Predicted size: 299
Derivations 
This marker was derived from EST read SGN-E120028
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39277)
Chromosome
5
Position
27.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14113
Forward primer (5'-3')
GGGTCACATACACTCATACTAAGGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGCAATCATAGCCACTTGGT
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 293+299
Solanum lycopersicum LA925: 297+299
Approximate temperature
55°C
  
Genomic location of SSR602  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1275 marker 1275
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)