SGN Marker TM13

SGN-M1283

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51044)
Chromosome
4
Position
61.97 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48980)
Chromosome
4
Position
102.87 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40145)
Chromosome
4
Position
113.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM13 was used as an overgo probe on plate 6 [well F8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATTGAGACTCTACCCACCGGTAG
B sequence
CCTCTTGTCAATGCGACTACCGGT
AB sequence
CATTGAGACTCTACCCACCGGTAGTCGCAT
Marker sequence
GGNCGACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCG
GCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGG
CTTCTGTCTTATTAACTTGGACACTTCTTCTTCTAGCATTGCATCAAGAG
TGGCAAGATAAAGCCTCGAGAAGAAGTTTTCCGAGTTTGTAAGGGTAACA
ACCTTCCAAGTGCAGAGAATCTGAATGATTTCAAGATTGTGACAATGATA
CTCAATGAGACATTGAGACTCTACCCACCGGTAGTCGCATTGACAAGAGG
AACTTCTAAAGACATCAAGTTGGGAGACCTTGAAATTCCTGCGAATACTC
AATTTTATGTGGCACTAGCTGCTGTGCATCATGACACTGGGATATGGGGG
AAAGATGCACTGGAATTCAACCCTCAGAGATTTGTCGAGTCTCGTAAGCA
TTTGGCTTCATTTTTCCCTTTTGCATTAGGTCCAAGAGTTTGTGTTGGGC
AAAACTTAGCCATGGTTGAAGCCAAAATCATCCTGGCAATGATAGTTAAG
AATTTCTCCCTTGCATTATCACCTTCATATGTTCATGCTCCAACCATGCG
TCTTACTATGCAG
Genomic location of TM13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1283 marker 1283
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)