SGN Marker TM39

SGN-M1306

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40171)
Chromosome
3
Position
73.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM39 was used as an overgo probe on plate 8 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGATTGCAAAGCATTCCACTTTGG
B sequence
CAGCTTCTTATTGTGACCAAAGTG
AB sequence
TGATTGCAAAGCATTCCACTTTGGTCACAA
Marker sequence
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTNNNNNGNNNANCCTGGCCGTCGTTTTNAAAAAGGGAC
AAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCC
CCCGGGCTGCAGGAATTTTCAGTATGTTCAAGGTAAAGATAGTATATTCT
TTAACTTTAGTAGCTGGTCATTGGGCATCATCTGATTATATGTTGAAATC
ATGATTGCAAAGCATTCCACTTTGGTCACAATAAGAAGCTGAAACTTGAT
GCAGATTCCACTATGATTACCTACATGCTTTTCTGTTGTAATTCCAATTT
TATGTGAAATATTGTTGTGCAGGATTTGAATCTTGTGGTTTTTCTCTTAA
TTAGTTCCTAGTCCTTGGTCCACTTTATTTTATACATGAACGTGTGTATG
ACATGTTTTGATTTGTTCACCATTGTAAAAGAATGAAATTTTCCTTTTAG
AGGGTACTCTATCTAACTATTAGATCAATTTCAGTATCAACTTCNNCGAG
CCTCNNTGACTGANAAAAGATGCATTTGCTTTCCTTAAAGCANACAGTGA
TGGTGATTNCATTACATATGCTGGGTTTTGNGNAANCACTCCGGCCCGTA
CTTCCCAGN
Genomic location of TM39  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1306 marker 1306
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)