SGN Marker P18

SGN-M1315

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C25552
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53840)
Chromosome
2
Position
59.60 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49353)
Chromosome
2
Position
42.29 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47289)
Chromosome
2
Position
94.39 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39128)
Chromosome
2
Position
87.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P18 was used as an overgo probe on plate 11 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACGCTAAGATCTCTCTCATCATG
B sequence
TCCTGGTGCTTGATAGCATGATGA
AB sequence
GACGCTAAGATCTCTCTCATCATGCTATCA
Marker sequence
TTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGATCTCTCT
CATCATGCTATCAAGCACCAGGAAGTATCATGAGTACACAAGCCCAAACA
CTACGACAAAAAAGATGATTGATCAGTATCAGAGTGCACTTGGAGTTGAT
ATCTGGAGCATTCACTACGAGAAAATGCAAGAAAACTTGAAGAGATTGAA
AGAGATCAATAACAAGCTAAGAAGAGAGATAAGGCAGAGAACAGGGGAAG
ACATGAGCGGACTAAATTTGCAGGAACTATGTCACTTGCAGGAGAACATC
ACTGAATCTGTTGCTGAGATTCGTGAACGAAAGTACCACGTGATCAAGAA
TCAAACAGACACCTGCAAGAAGAAGGCGAGGAACTTAGAAGAGCAAAATG
GAAACCTTGTACTTGACTTGGAAGCAAAATGTGAAGATCCAAAGTATGGT
GTTGTGGAAAATGAGGGGCATTACCACTCTGCTGTGGCATTTGCGAATGG
AGTACACAATCTTTATGCTTTTCG
Genomic location of P18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1315 marker 1315
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)