SGN Marker P47

SGN-M1323

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C24411
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49354)
Chromosome
11
Position
0.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39136)
Chromosome
11
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P47 was used as an overgo probe on plate 3 [well A3]

Plausible BAC Matches:   P070N19,   P058E08,   P168B23

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACCCTTTTACTCCCTCTACCTAC
B sequence
CTCCTCCTCATCAATCGTAGGTAG
AB sequence
CACCCTTTTACTCCCTCTACCTACGATTGA
Marker sequence
GCACCAGCTCACTTCCAATTCATGATCATAGGGTGGAACAATATGATGAA
ATAACAAAAATGAAAAGAGAAACATTGAATCTTGAATTAAGTCTTCAAAG
ATACAAAGGTGATGAATTGAACTCAGCACAATATGATGAATTAAATGAAC
TTGAGAAGCAGCTTGAAAATTCTATTAACAAAATTAGAGCCAGAAAGCTT
GAACTCTTGCAACAGCAGATGGAAAACCTGAAGAGAACAGAGAAAATGTT
GGAGAAAGAAAATCATGATATGTGTCAGTGGTTGATGAAGTATGAAATGT
ACAAGCAACAGCCAGTAGCAATGATGGAGCAACAAGAAGAAGCAGCAATT
ACTGAACTGAATTTACTTGGAGAACAACCATTGTTGTCTCAATTTTCATT
CTTTGGAGATCAACACCAACTTGGTACTACAAGTAATTCTTCAGCATATC
ACCTTCAAACTTCTCACCCTTTTACTCCCTCTACCTACGATTGATGAGGA
GGAGCTGCAATTGCTGGGGATAATTAATTCTACATTTCCTTTGGCATATT
TAGAAGCTATA
Genomic location of P47  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1323 marker 1323
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)