SGN Marker P56

SGN-M1328

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C128443
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49356)
Chromosome
4
Position
58.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47291)
Chromosome
4
Position
72.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39141)
Chromosome
4
Position
88.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P56 was used as an overgo probe on plate 7 [well D7]

Plausible BAC Matches:   P120F07,   P269L11,   P314N04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AAACTCGTGAGCTCAGGCAGATGA
B sequence
TCAAGTTCCTCACCTCTCATCTGC
AB sequence
AAACTCGTGAGCTCAGGCAGATGAGAGGTG
Marker sequence
GGTGAATAGTACTTATTCCATCTCCAAAATTAGGTCTTACATATTTCTAT
ACTCAATTATTGGCCCATTTTTGTATAGGTTTTCTAACTAGATCTAAAGT
TTTCCTCTTTTATTAGGGTTTCTTACAATTTCTTACTATTTATATCTTTT
GTGAGATTTCTTAGAAAGTTTGAGGAAAGATAATTAGCTTCTTCGACCTG
TTAAGGATGGCAAGGGAAAAGATAAAAATAAAAAAGATAGATAATATAAC
AGCAAGACAAGTAACATTTTCAAAGAGGAGAAGAGGGCTTTTTAAGAAAG
CTGAAGAGCTTTCTGTTCTTTGTGATGCTGATGTTGCTCTTATCATTTTT
TCTGCTACTGGAAAGCTATTTGATTTTGCCAGCACCAGCATGAAGGATAT
TCTTGGAAAGTATAAATTGCAATCAGCTAGCCTTGAGAAAGTTGACCAAC
CTTCCCTTGATTTACAGCTAGAGAATAGCCTCAACATGAGATTAAGCAAG
CAGGTAGCTGATAAAACTCGTGAGCTCAGGCAGATGAGAGGTGAGGAACT
TGAAGGATTGAGTTTAAAGAATTACAAC
Genomic location of P56  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1328 marker 1328
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)