SGN Marker P71

SGN-M1340

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C18582
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39152)
Chromosome
7
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P71 was used as an overgo probe on plate 7 [well H12]

Plausible BAC Matches:   P275L24,   P031J01,   P012C12,   P318N10,   P019A06,   P120B12,   P290B04,   P127B13,   P252O03,   P109D12,   P030J16,   P018J14,   P272A15,   P022E01,   P095P04,   P085I08,   P283A16,   P001O18,   P017E22,   P117K05,   P268N15,   P089H15,   P015E20,   P089E23,   P257N07,   P106D10,   P008C01,   P012K16,   P099D04,   P102O17,   P011O14,   P039A08,   P334J11,   P260G24,   P262P20,   P251K24,   P260K09,   P018D22,   P060J02,   P056D09,   P313O09,   P330A05,   P128K16,   P276K18,   P291M05,   P305H16,   P010E03,   P127M19,   P308B02,   P250H17,   P139D18,   P128P15,   P099L02,   P324D15,   P299P18,   P300G12,   P318I16,   P024J09,   P331I15,   P241I08,   P136A20,   P072J09,   P104B02,   P302M21,   P268E24

 Overgo Sequences

A sequence
CCCGTCAACAGTTCTATTCAAAGC
B sequence
AGGATGGTATCCTTGCGCTTTGAA
AB sequence
CCCGTCAACAGTTCTATTCAAAGCGCAAGG
Marker sequence
TTGCGAGTGTCCAAGTCCACAATATGTAGAGTGTCCTCTTCCTTTTATGG
AGTTATGGTCTAATAGCCAAAGAGGAAAAAGAACATCAAGAAGGAAAAGC
TCTATGTGGTATTGAGGATTCTCATCAAATTAAAATGGATACTCTCTCCT
AATAGAAAAGTTAACGAACAATTAATCATGAGGGAACTTCATGGCATTTG
TAGCCTAACTTGAATAAGTTTCTTGGATTGGCTTGACCTAAATAGAAGGA
AGCTCGAGCTACATTGCAAAAGCTTTTATCAGCTTGTGATGAAGAAAATT
GAGGATCCAACATCCCGTCAACAGTTCTATTCAAAGCGCAAGGATACCAT
CCTTAAGAAGTCCAATGAGTTGGCTGTTTTATGTGATGGGGATGTTGGTC
TTCTAATG
Genomic location of P71  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1340 marker 1340
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)