SGN Marker P75

SGN-M1344

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C123761
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39154)
Chromosome
1
Position
30.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P75 was used as an overgo probe on plate 9 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTATGAACAAGTCTGTGAATCCG
B sequence
GATTTGGTATGGGTCGCGGATTCA
AB sequence
GCTATGAACAAGTCTGTGAATCCGCGACCC
Marker sequence
GTTCCACTGCTGTTTTCATCTCCAAAGCTAAGGCGAAAATATTAGAATTT
TTCATCTAAAAGCTCCCAAGCTAACTTCATGCTTCTCTCCAAGCGATTTT
TTTCGAAGTAGAGTACTACGGATCCAAAAGATTTCATTTCAATCTACCAA
AATCAAGTTCTAGTTTGCATCTTCTCATGGGTCGCAATAAGATTGTGATG
AAGAAAATTGAGGATTCAACATCCCGTAAACAGTTCTATTCAAATCGCAA
GGATAGCATTGTGAAGAAGTCAAATGAGCTGGCGGTTGTATGTGGTACAG
ATGTGGGGTTGTTGATGTTTTCTCCATCTGGTCAGCTGACTACCTATTCT
AGCAAAGAAAGTATTGAGGACATCATGATCGAAGCTATGAACAAGTCTGT
GAATCCGCGACCCATACCAAATCTAAATGAACAGCTTTTGATGCAGAGTC
TCAAACAGTCAAAATCTGAAGGCCAAATGGTTGG
Genomic location of P75  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1344 marker 1344
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)