SGN Marker T0266

SGN-M1391
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TOVBN23TH
Arabidopsis best BAC match: AL022603.1
Arabidopsis position: 4.1110000
Arabidopsis identities: 0.873
Best GenBank protein hit: CAB81052.1
Evalue: 1.9e-73
Identities: 0.816
Description: MYB-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39819)
Chromosome
2
Position
67.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0266 was used as an overgo probe on plate 10 [well H12]

Plausible BAC Matches:   P103O01,   P079M14,   P320E07,   P190D15,   P148C04,   P328B02,   P018D12,   P311M09

 Non-Plausible BAC matches

P059M17,   P156O06,   P078P08,   P166G08,   P124N18

 Overgo Sequences

A sequence
GGAGGACTCTTCCAAAGAATGCTG
B sequence
CCACATCTTTGAAGCCCAGCATTC
AB sequence
GGAGGACTCTTCCAAAGAATGCTGGGCTTC
Marker sequence
CATGGATATGGTAATTGGAGGACTCTTCCAAAGAATGCTGGGCTTCAAAG
ATGTGGAAAAAGTTGTAGGCTTCGTTGGACTAATTATCTAAGGCCAGATA
TTAAAAGAGGAAGATTTTCATTTGAAGAAGAGGAGACTATCATTCAACTC
CACAGTATTTTAGGCAACAAGTGGTCTGCTATTGCTGCACGTTTACCTGG
TAGAACTGATAATGAAATCAAGAACTATTGGAATACGCATATCAGGAAAA
GGCTTTTGAGAATGGGGATTGATCCAGTGACACACAGTCCACGTCTTGAT
CTTCTTGATCTTTCTTCCATTTTAAACCATTCAATTTACAATAATTCATC
TCATCATCAAATGAACCTTTCAAGATTGTTAGGCCATGTGCAACCTTTGG
TTAATCCTGAACTCTTGAGATTAGCTACTTCTCTTATATCATCCCAACGC
CAAAACACAAACAAC
Genomic location of T0266  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1391 marker 1391
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)