SGN Marker T0463

SGN-M1438
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPSAA16TH
Arabidopsis best BAC match: AC069159.6
Arabidopsis position: 1.1005000
Arabidopsis identities: 0.940
Best GenBank protein hit: AAC26785.1
Evalue: 7.8e-83
Identities: 1.000
Description: phosphoglycerate kinase precursor [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42376)
Chromosome
7
Position
117.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43841
Forward primer (5'-3')
CCAAGGCAAAAGGAGTCAGTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GAACCAAAGTTGTCGCTGTCTAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41617)
Chromosome
7
Position
120.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43585
Forward primer (5'-3')
CCAAGGCAAAAGGAGTCAGTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GAACCAAAGTTGTCGCTGTCTAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39830)
Chromosome
7
Position
112.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39831)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Genomic location of T0463  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1438 marker 1438
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)