SGN Marker T0586

SGN-M1486
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAA47THB
Arabidopsis best BAC match: AC008113.4
Arabidopsis position: 1.1330000
Arabidopsis identities: 0.764
Best GenBank protein hit: AAF26948.1
Evalue: 1.4e-66
Identities: 0.730
Description: similar to thimet oligopeptidase sp|P47788 (deleted) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39369)
Chromosome
5
Position
65.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0586 was used as an overgo probe on plate 1 [well D2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGACCTCAGATGTGATTGAGCTTC
B sequence
AGCTTATCTGGTGTCGGAAGCTCA
AB sequence
CGACCTCAGATGTGATTGAGCTTCCGACAC
Marker sequence
CACCTCAAAAAATTGAGGAAGAAAACAGAAAAATAGAAAAAATGGAGGTG
GCTATGTCTTTGAATCCTCTTGTTAGATTACCTCTTTCAAATTCAAGAAC
CCATGAAGAATTTTCAGTGCTAAAACATTCCGTTGTTTCGACAACAAATA
GAAGAATTCAGAAGAGGAAATTGTTAGTGGTTGAAGCAAAAGGAAGAAAA
GGAGGTATGGCTGCTCGTCAGTACCAACGTATGGCTCCTCCTATGCCCAA
GATTGAAGATGATGGAAACCCTAAATTCGTTATTTTTATACGAATGGCTA
ATGTTTACCTTTGGTACCCCCTCAATATCATAACAGGTGGCACAACTGCA
AAAATTATGGTTGCTGCAAAAGACAACTTTCTTGGGAAATATATATACGA
AGATACTCTAGCTAGGAATCTCGCAGCACTGATTTACAATGACGAGAAGG
AAATAAAGAAATTGGCAATGAAACAGCATCGTGTATTGAAGTCTGCCACA
GAATTTAGATATGGATACAAACTTGTCGAGAATAACAATTTGAGAGCTGC
CCTTTCGACCTCAGATGTGATTGAGCTTCCGACACCAGATAAGCTTAAAA
CAGTTGTT
Genomic location of T0586  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1486 marker 1486
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)