Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker TES1907

SGN-M14976

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50312)
Chromosome
3
Position
25.05 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48247)
Chromosome
3
Position
59.26 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45334
Forward primer (5'-3')
GAAACCCAAGAACACAGCAGC
Accessions and product sizes
Solanum lycopersicum LA925
136
Approximate temperature
55°C
Reverse primer (5'-3')
CGTGGTCTCAACCCAATTTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1907  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14976 marker 14976
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)