SGN Marker TG465

SGN-M150

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG465 image not available
Forward sequence
AAGTTGAGAAGAAAGTGGATGAGAATGCTACTGCTGAACCATCAGTTGAAGACGCTCAGAAGTTGGAGACAGAGACTAAAGATCTGAAGA
CTGCTGAAGGTGAGAAAGAAGTTGAGGAGACAGCAAAAACAGAAGCTCCTAAGGATGGTGAAGACAAGAAAACTACAGAAGAAGTACCAG
TAAAGACAAAGCAGTCAAATAACCTTATGTCCAAGGTGAAGCAGTCTCTTGTGAAGGCTAAGAAAGCAATCATTGGAAAGTCTCCCGGCT
CTAAATCTGATACAAAGAATGAAGTTAAAACCAAATAAGATAAAGGGAAGAAACATTACAATGATCATAAGTGAGTTGTTTTATTAGTTG
TGTGATCTTTATTTTTTCTTTTCCTAAACCTTTTTTTCATTTTTTTGGGTCAGATATATTGGTTGCTCTGTTCGGGATGTCGTATGATT
Reverse sequence
CTGTAGTTGAACTTGACACAAGCCTTAACGGTTGGTTAGTATAAATTTTAAAAACTTGAAAGTTGCTAATGAGAAGAAGCTGCAAAGAAG
CAGTCCTTTTCACGCCATTAATCCAGCTTGATAGTGAATTTATTGCACATGTAGCTTCTATGCCCAAGCTTTGAATCCATTAATTTCCTC
TGATGAGAATTGTGTTGTGCATAGCATCATTTTTAAGGATGAGACGTGTGCGTCTCCTCATCACTTCTTTTATATATGCTGGATCCTGTA
TGCATATATACTTTTTGTTTCCCAAAAAATGGATACCACATTTACATTGGATGTGCAGACAGTCCCACATTTATACGACTGACTACACAA
GTAATCTCATAAATAGAGATTTTTTAACCATGACAAGCAACAATAAAAAGGCTTTGCAGCAAGAACAAGCCTACATGTAGAAAATATGAC
ACTTTATGTACATCATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1500281.4e-1643 (9.6% of RFLP seq)+
SGN-U150028367 (81.7% of RFLP seq)+
SGN-U1500289.6e-1853 (11.3% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43869)
Chromosome
1
Position
101.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43612)
Chromosome
1
Position
83.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43331)
Chromosome
1
Position
103.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40873)
Chromosome
1
Position
116.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8315)
Chromosome
1
Position
89.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8316)
Chromosome
1
Position
122.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG465 was used as an overgo probe on plate 14 [well B10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTGCTGAACCATCAGTTGAAGACG
B sequence
GTCTCCAACTTCTGAGCGTCTTCA
AB sequence
CTGCTGAACCATCAGTTGAAGACGCTCAGA
Marker sequence
AAGTTGAGAAGAAAGTGGATGAGAATGCTACTGCTGAACCATCAGTTGAA
GACGCTCAGAAGTTGGAGACAGAGACTAAAGATCTGAAGACTGCTGAAGG
TGAGAAAGAAGTTGAGGAGACAGCAAAAACAGAAGCTCCTAAGGATGGTG
AAGACAAGAAAACTACAGAAGAAGTACCAGTAAAGACAAAGCAGTCAAAT
AACCTTATGTCCAAGGTGAAGCAGTCTCTTGTGAAGGCTAAGAAAGCAAT
CATTGGAAAGTCTCCCGGCTCTAAATCTGATACAAAGAATGAAGTTAAAA
CCAAATAAGATAAAGGGAAGAAACATTACAATGATCATAAGTGAGTTGTT
TTATTAGTTGTGTGATCTTTATTTTTTCTTTTCCTAAACCTTTTTTTCAT
TTTTTTGGGTCAGATATATTGGTTGCTCTGTTCGGGATGTCGTATGATT
Genomic location of TG465  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D150 marker 150
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)