SGN Marker T0635

SGN-M1512
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TMEAH31TH
Arabidopsis best BAC match: AB006704.1
Arabidopsis position: 5.0190000
Arabidopsis identities: 0.871
Best GenBank protein hit: AAB97152.1
Evalue: 3.0e-57
Identities: 0.914
Description: Mg protoporphyrin IX chelatase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53146)
Chromosome
4
Position
25.23 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49529)
Chromosome
4
Position
6.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47463)
Chromosome
4
Position
35.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42378)
Chromosome
11
Position
98.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41619)
Chromosome
5
Position
11.10 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43587
Forward primer (5'-3')
TCAACCAACAACAAGGGTCA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
CCAGGAGCATCACAGTCAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39382)
Chromosome
4
Position
55.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10679)
Chromosome
11
Position
99.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Other PCR data 
PCR data   Exp. ID 14101
Forward primer (5'-3')
TCAACCAACAACAAGGGTCA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCAGGAGCATCACAGTCAAA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Solanum lycopersicum LA925: 900
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
T0635 was used as an overgo probe on plate 7 [well E7]

Plausible BAC Matches:   P004N07,   P209A01,   P114C15,   P116I09,   P206I23,   P149A16,   P025H22,   P099P20,   P123C09,   P062J03

 Overgo Sequences

A sequence
CACTCGGAATTGATGGTCGTGAAG
B sequence
AAGACCCTAGTAGCTGCTTCACGA
AB sequence
CACTCGGAATTGATGGTCGTGAAGCAGCTA
Marker sequence
TGAACCGGAAGACCAAAACTTTGTCAGGAAACATGCACTAGAACAGGCAA
AAACACTCGGAATTGATGGTCGTGAAGCAGCTACTAGGGTCTTCTCAAAC
GCTTCGGGTTCTTACTCTTCCAACATCAACCTAGCTGTTGAGAACTCATC
ATGGAACGACGAGAAGCAACTTCAAGACATGTACTTGGGCCGGAAGTCAT
TTGCATTTGACTGTGATGCTCCTGGTGCTGGCATGATGGAGAAGAGGAAA
GATTTTGAGATGGCTCTAAGCACAGCTGATGCCACGTTCCAGAACCTCGA
CTCATCAGAAATTTCACTCACAGACGTTAGTCACTACTTCGATTCAGATC
CA
Genomic location of T0635  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1512 marker 1512
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)