SGN Marker T0671

SGN-M1534
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TMEAH96TH
Arabidopsis best BAC match: AB023041.1
Arabidopsis position: 3.0820000
Arabidopsis identities: 0.766
Best GenBank protein hit: BAA90524.1
Evalue: 1.6e-26
Identities: 0.732
Description: peroxiredoxin Q [Sedum lineare]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42394)
Chromosome
7
Position
59.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39389)
Chromosome
7
Position
27.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10723)
Chromosome
7
Position
65.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0671 was used as an overgo probe on plate 8 [well C9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTATCGGGCTCTGTAAAACACAC
B sequence
GAGCAGAGAAGGAAGAGTGTGTTT
AB sequence
TCTATCGGGCTCTGTAAAACACACTCTTCC
Marker sequence
AAAATGGCTTCTCTATCGGGCTCTGTAAAACACACTCTTCCTTCTCTGCT
CCAATATGCTCAAACCCCAAAAAAACCCATCTCCCAAAACCTTACCATTG
TCTCCAGATCATCACAATCCCATTTTTATGGCCTTGAAGTCCTTCATTCA
CCTTCTTTTTCAACCCCATCTTCTTCAAGAACTTCAATTGTTGCTAAGGC
GAATAAAGGTTCAGCGCCTCCACCATTCACATTGAAAGATCAAGATGGAA
AAAATGTGAGTCTCTCCAAGTTTAAAGGAAAGCCTGAGGTGGTTTATTTC
TACCCTGCTGATGAAACTCCTGGGTGCACCAAACAGGCATGTGCCTTCAG
GGACTCTTATG
Genomic location of T0671  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1534 marker 1534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)