SGN Marker T0677

SGN-M1539
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI18TH
Arabidopsis best BAC match: AL021960.2
Arabidopsis position: 4.1090000
Arabidopsis identities: 0.722
Best GenBank protein hit: CAB79119.1
Evalue: 4.0e-60
Identities: 0.607
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49537)
Chromosome
3
Position
2.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47471)
Chromosome
3
Position
39.88 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39846)
Chromosome
3
Position
48.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0677 was used as an overgo probe on plate 6 [well B12]

Plausible BAC Matches:   P045B01,   P257N18,   P270J20,   P019G03

 Non-Plausible BAC matches

P312P10,   P106H01,   P243M03

 Overgo Sequences

A sequence
TGTTAAACGCCTTGGCTGAGGATG
B sequence
GCTTCCTCAAGTCTTCCATCCTCA
AB sequence
TGTTAAACGCCTTGGCTGAGGATGGAAGAC
Marker sequence
TTCTTGAGAATGAAAAAGAGTGGAAAAGGATAATTCAGGTGACAAAGTGG
ATGTTGAGTAAAGGTCAAGGGAGAACAATGGGAAGCTATTTTGCATTGTT
AAACGCCTTGGCTGAGGATGGAAGACTTGAGGAAGCTGAAGAGCTTTGGC
TGAAACTATTCTCTCAGAATCTGGAAAGCATGCCTCGTATTTTCTTTCAG
AAAATGATAGCCATATATTATCACAAGGAGATGAATGAGAAGATGTTTGA
GATATTCGCAGACATGGAAGAGCTTGGTATTAGGCCAACTGTGCCAGTTG
TCAAAATGGTGGGAAATGTTTTTCAGAAACTGGGAATGTTGGACAAGTAC
CAGAAATTAAATAAGAAATATCCACCTCCAAAGTGGGAATATCGATACAT
AAAAGGGAAGAGGGTTAAAATAAGAACAAAAGATCTTGATAAATCTCACG
ATCATGATGTTGAAAGTAACTCTGAAGAGGTAGATGAGTCTGAGTTCGAC
GAGAACTCACAAGATCAAGAAAATGAAGATTATGTAGAGCAAATCGAAGA
CGCTGAAGAGTGTGAACCTGCTGAAGTATCAGTTGTATCTAGTGAAACAA
GGGAATCCTCTATGTCAACTTAATGATTTGAATTCCTATAAAGTTATCAT
TCGTTCGAC
Genomic location of T0677  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1539 marker 1539
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)