SGN Marker T0728

SGN-M1569
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDB73TH
Arabidopsis best BAC match: AB006708.1
Arabidopsis position: 5.0370000
Arabidopsis identities: 0.662
Best GenBank protein hit: BAB09822.1
Evalue: 2.5e-77
Identities: 0.722
Description: acetyl-CoA synthetase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49549)
Chromosome
3
Position
58.52 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47483)
Chromosome
3
Position
82.28 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39408)
Chromosome
3
Position
103.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0728 was used as an overgo probe on plate 1 [well H8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCCCCTAGACCATTTGATTCTCC
B sequence
CATTTCACCAACTCCGGGAGAATC
AB sequence
GTCCCCTAGACCATTTGATTCTCCCGGAGT
Marker sequence
TTCATTGCTGGTTCGTTGTTGCAACCACAATCTTTATCTGCTTTTAGCAC
AGCAGCTATGGGTTGTAGTCTATTCATTCTTGGCGAAGATGGGTCCCCTA
GACCATTTGATTCTCCCGGAGTTGGTGAAATGGCTCTTGGTCCCCTTCTA
TTTGGGGCATCAAGCACATTGCTGAATGCTGACCACTATGGTGTATACTA
CAAAGGAATGCCTGTTTGGAATGGAAAGGTTCTTAGAAGACACGGAGATA
TATTTGAGCGTACTTCTAGAGGTTATTACCGTGCACATGGCCGTGCAGAT
GACACCATGAATCTGGGGGGCGTAAAGGTAAGTTCAGTGGAGATTGAGAA
AGTTTGTAATGCAGCTGATGAAAGTATCCTCGAGACAGCAGCTGTTGGGG
TGCCACCACCTGGAGGTGGCCCTGATAAGTTAGTTATCGCCGTTGTATTT
AAGGATTCTAAGGGGTCAAAGGACAATATGAATTCATTGAAAGTTTCTAT
CAACTCAGCTTTGCAGAAGAAATTGAATCCTCTATTCAAGGTTTCACATA
TAGTAGCCCTCCCTTCACTTCCAAGAACAGCAACAAATAAAGTGATGAGA
AGAGTGTTGAGACAACAATTTTCTCAA
Genomic location of T0728  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1569 marker 1569
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)