SGN Marker T0758

SGN-M1585
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TMEAL40TH
Arabidopsis best BAC match: AF007269.1
Arabidopsis position: 4.0080000
Arabidopsis identities: 0.794
Best GenBank protein hit: CAB80940.1
Evalue: 4.7e-48
Identities: 0.666
Description: putative L5 ribosomal protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39420)
Chromosome
1
Position
89.50 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39421)
Chromosome
9
Position
11.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0758 was used as an overgo probe on plate 14 [well F10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGAAGGTCAACCGCTTGGAATTGC
B sequence
CCCTCGAAGTGTAACAGCAATTCC
AB sequence
AGAAGGTCAACCGCTTGGAATTGCTGTTAC
Marker sequence
GAGAAAATGGCGGCTTCTCCTCTTCTTCTACACTCCACGGCCTCCTCTTT
CTACAATGCTGAGTTTCCGGCGTACTCCGTTCGATTGCCGGTCGGAAATA
CCAAGGTCCGGTCGTCCAATAAATTGACGGTGAAAGCTTCAGCAACAGTA
CTAGTGGATAAAAGTGAAGCTGAAAAAGTTAATCGTCTGAAAACAAATTA
CCTCGAAAAGATTGTGCCGTTGTTGAAGGAAGAATTCAGTTACACCAATA
TTCTTCAGGTTCCGAAGGTCGAAAAGATTGTGGTAAATTGTGGTATAGGA
GATGCTGCACAAAATTCCAAGGGTTTGGATGCAGCAATGAATGATTTGGC
CTTAATTACAGGGCAAAGGCCTGTGAAGACTAGGGCTAAGAATGCTATTG
CTACTTTCAAAATTAGAGAAGGTCAACCGCTTGGAATTGCTGTTACACTT
CGAGGGAATGTAATGTATTCGT
Genomic location of T0758  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1585 marker 1585
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)