SGN Marker T0759

SGN-M1586
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAL42TH
Arabidopsis best BAC match: AL031986.1
Arabidopsis position: 4.1830000
Arabidopsis identities: 0.634
Best GenBank protein hit: CAB81484.1
Evalue: 6.0e-32
Identities: 0.703
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49555)
Chromosome
2
Position
41.29 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47489)
Chromosome
2
Position
90.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39422)
Chromosome
2
Position
82.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0759 was used as an overgo probe on plate 10 [well G12]

Plausible BAC Matches:   P291K08,   P098I01,   P136G17,   P155F10,   P310I23,   P101P16,   P071A04,   P067G03,   P335C01,   P122M11,   P041K02,   P228D06,   P005P17,   P207P20,   P052J15,   P002I05,   P054E09,   P258J12,   P033P05,   P031L11,   P170B23,   P028I20,   P168N23,   P076H19,   P261L10,   P060J03

 Overgo Sequences

A sequence
GATCCAAGGCAGAGATAAACGTGG
B sequence
GCGCAAAATTTTGCGGCCACGTTT
AB sequence
GATCCAAGGCAGAGATAAACGTGGCCGCAA
Marker sequence
CAAACGTAGCGTTTTGCTTTTGCAACAATCGAGATTCAAAAAACCATGTT
TACAGAAGTTGAACAACAACAGCATATAGAGAAACTCGAAATATTCAAGA
TCCAAGGCAGAGATAAACGTGGCCGCAAAATTTTGCGCATCATCGGAAAA
TTCTTTCCTGCTAGAAATCTGAGTGTTGAAGTTGTGAACAAGTATTTAGC
GGAGAAGATCTTTCCGGAACTTGAGAAAAGGCCGGTCGCCGGGGTGTATG
TTCACACCGATGTGGAGAAAAGCGAGAATTTCCCCGGAGTATCAGCTTTA
CGATCGGTCTACGATGC
Genomic location of T0759  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1586 marker 1586
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)