Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T0761

SGN-M1588
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI59TH
Arabidopsis best BAC match: AC010924.2
Arabidopsis position: 1.0430000
Arabidopsis identities: 0.762
Best GenBank protein hit: AAF18512.1
Evalue: 2.4e-80
Identities: 0.824
Description: Contains similarity to gb|AF181686 membrane protein TMS1d from Drosophila melanogaster (e-14). [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49556)
Chromosome
3
Position
60.86 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47490)
Chromosome
3
Position
100.72 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39425)
Chromosome
3
Position
133.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0761 was used as an overgo probe on plate 6 [well C7]

Plausible BAC Matches:   P012D06,   P161B02,   P269D10,   P114J11,   P252D23,   P166B15,   P115B09,   P054N10,   P300N10,   P128E06,   P276K19,   P080N21,   P093C21,   P249D16

 Overgo Sequences

A sequence
TGGGTTGGATACGATGAGCAGTTC
B sequence
GCAATGCCACATACCAGAACTGCT
AB sequence
TGGGTTGGATACGATGAGCAGTTCTGGTAT
Marker sequence
TGGACTTTGTGCACAGTTGGAATGACAAATGGGTTGGATACGATGAGCAG
TTCTGGTATGTGGCATTGCTTGTCGTTTCACTTGTATGTTATGTGGCTAC
CTTTGCATTCAACGGACTGCTCTTCCACTTTTTCACTCCATCTGGACAGG
ACTGTGGGCTTAACACTTTCTTTATAGTGATGACACTTATATTGATCTTT
GGCTTTGCTGTTGTTACATTGCATCCATCGGTAGGTGGAAGTATTTTACC
TGCATCAGTTTTATCCCTGTACTGCACATACCTCTGCTACAGTGCACTTG
CAAGTGAACCTAGGGATTATGAGTGCAACGGTCTACATAAGCACTCCAAG
GCTGTTTCCAGTGGCACACTTGCATTAGGGTTGCTAACAACAGTTCTATC
TGTTGTCTACTCTGCTGTTCGCGCTGGCTCTTCTACGACTCTGCTTTCTC
CTCCAAGCTCACCACGTGCAGGCTCAGGGAAGCCCTTGCTACCGTTGGAC
AAGGTTGATGAGGAGGAAGAAAAAGAGAGATCTAAGCCAGTCTCATACTC
CTATTCTTTCTTCCACCTTATCTTTTCTCTCGCTAGTATGTACTCGGCAA
TGCTTCTTACGGGTTGGTCAACCTCTGTGGGGG
Genomic location of T0761  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1588 marker 1588
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)