SGN Marker T0769

SGN-M1594
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI68TH
Arabidopsis best BAC match: AC007915.3
Arabidopsis position: 1.0860000
Arabidopsis identities: 0.628
Best GenBank protein hit: AAF78277.1
Evalue: 3.3e-43
Identities: 0.703
Description: Contains similarity to hypothetical protein F27F5.3 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49558)
Chromosome
4
Position
60.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47492)
Chromosome
4
Position
81.75 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39428)
Chromosome
4
Position
94.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0769 was used as an overgo probe on plate 6 [well H9]

Plausible BAC Matches:   P203P08

 Overgo Sequences

A sequence
GCCTTTGCGATTTTCTCCTCAATG
B sequence
CTGGAATTCTGGACCTCATTGAGG
AB sequence
GCCTTTGCGATTTTCTCCTCAATGAGGTCC
Marker sequence
CCCACGTGCATTATACTTTCCCAATTTCGTACCGCAAAACATTAAATGCC
TCTCCGTGTGTCCTGGGGATCATAGTCGCCTTTGCGATTTTCTCCTCAAT
GAGGTCCAGAATTCCAGTTTTGTCTTCAGATGCAAGATAGTGTTCCTCTG
GAAGGTGTTATTCAGTTTGAGAAACCTGATTCTAATTCAATTAGTGATAA
AATTAATAAATGGGGCTGGGTGGCGTTGTTAGCTGGTGGAGATGTTGCGG
TTTTGTTGTTATTCTCTGCAATTGGAAGGTTTAGTCATGGATTCGCTGTT
TTTGACTCCGAAACACTGCGAACTGCTGACCCCTTCATTGCTGGTTGGTT
GTTGAGTGCGTATTTCCTTGGAGGATTTGGCGAGGATGGTAAAGGAAAGA
ATGGTCTGTTTAAGGCTTTCATTGCTGCTACTAAATCATGGTCATTAGGC
ATTCCGTCTCCGCTTCTCTTATTGTGCAGCTGGGTATAGCTATAAGGGCT
GCCTCTGTGGGTCATATACCACCAGTCAACTTCATAATAGTTACCATGGG
GAGTACTGCTGTACTACTCATTGGATGGAGGACCCTCTTGTTCAGCATTT
TACCAACGGACAAGCCGAAGAAGAATGATGTTTATAAGAGCGGAAACCCT
TTTGAATTTCTTGAGTTG
Genomic location of T0769  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1594 marker 1594
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)