SGN Marker T0778
SGN-M1599
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis
| Synonyms |
| Locus associations |
| COS information |
MIPS Category: 2.30.03
Tomato EST read: TMEAL73TH
Arabidopsis best BAC match: AC007576.3
Arabidopsis position: 1.0375700
Arabidopsis identities: 0.604
Best GenBank protein hit: AAC49566.1
Evalue: 1.0e-28
Identities: 0.753
Description: "ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase [Nicotiana tabacum]"
Comment: enzyme catalyzes the posttranslational methylation of the epsilon-amino group of Lys-14 in the LS of Rubisco
More information about COS markers can be found on the COS markers page.
Tomato EST read: TMEAL73TH
Arabidopsis best BAC match: AC007576.3
Arabidopsis position: 1.0375700
Arabidopsis identities: 0.604
Best GenBank protein hit: AAC49566.1
Evalue: 1.0e-28
Identities: 0.753
Description: "ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase [Nicotiana tabacum]"
Comment: enzyme catalyzes the posttranslational methylation of the epsilon-amino group of Lys-14 in the LS of Rubisco
More information about COS markers can be found on the COS markers page.
Mapped locations
|
| ![]() Tomato-EXPEN 2000 |
| Overgo hybridization and physical mapping |
T0778 was used as an overgo probe on plate 12 [well H9]
Plausible BAC Matches: P144P09, P206G13, P048E10, P288N08, P167M10, P251N01, P297D09, P252H03, P223D23, P027E06, P206A16, P027H13, P103K01
Non-Plausible BAC matches
Overgo Sequences
|
A sequence
CCAGAACCAGTCCAAACATTCTGG
|
|
B sequence
CATCACATAGCCACTTCCAGAATG
|
|
AB sequence
CCAGAACCAGTCCAAACATTCTGGAAGTGG
|
|
Marker sequence
TGGAAATCTAGTTACTCTGAAATCCAGTAGAACCAAGCTAAGCTAGAAAA
AATGGCTTCTGTTTTCTCTTTACCCTCTTCATCTTTCCTCTGTCCACTCA AAACCACAAGATTCAGAACAAAGATTCAATCTTTACACAGTTCCCCAAAA TCACTCTTGATAAACTCTCTTCAGTTGCAAGAACTTGACCCAAATATCCC AGAACCAGTCCAAACATTCTGGAAGTGGCTATGTGATGAAGGAGTTGTAT CAGCAAAGACACCTGTAAAGCCAGGAATTGTACCAGAAGGTTTAGGGTTA GTTGCTAAGAGAGATATAGCTAAAGGGGAGACAGCTCTAG |
Related Markers
|
Related Genotyped Markers: These markers have been genotyped and share a name with this marker
Genomic location of T0778
|
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Mapped locations
Mapped locations

