SGN Marker T0784

SGN-M1602
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TMEAI86TH
Arabidopsis best BAC match: AC002131.1
Arabidopsis position: 1.0370000
Arabidopsis identities: 0.845
Best GenBank protein hit: CAA81081.1
Evalue: 7.0e-86
Identities: 0.988
Description: T-protein [Solanum tuberosum]
Comment: T-protein of glycine decarboxylase multienzyme complex
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39433)
Chromosome
2
Position
74.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0784 was used as an overgo probe on plate 11 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTTAGGAGCTCGTGACAGTCTTC
B sequence
AATCCAGCCTCAAGACGAAGACTG
AB sequence
GTTTAGGAGCTCGTGACAGTCTTCGTCTTG
Marker sequence
AGATTTGAGCAAGATGTACTTTGGGGAATTCAAGGTTTTGGATATCAATG
GGGCACCATGCTTCCTCACAAGGACAGGGTATACTGGTGAAGATGGATTT
GAAATTTCAGTACCTTCAGAAAATGCTCTTGATCTTGCAAAAGCTCTTCT
TGAGAAATCAGAAGGGAAGATTCGGTTAACAGGTTTAGGAGCTCGTGACA
GTCTTCGTCTTGAGGCTGGATTGTGCTTATATGGTAATGACATGGAGCAG
CACACAACACCTGTAGAGGCAGGGCTTACATGGGCCATAGGGAAGAGAAG
AAGGGCAGAAGGAGGCTTCCTTGGTGCTGAGGTAATACTAAAGCAAATTG
AAGAAGGTCCTAAAATCAGGCGAGTTGGCTTTTTCTCTTCAAGCCCACCC
CCTAGAAGTCACAGTGAAATTCAAGATTCAAATGGACAAAATATTGGAGA
AATCACCAGTGGTGGTTTCAGCCCTTGTCTGAAGAAGAACATAGCAATGG
GATACGT
Genomic location of T0784  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1602 marker 1602
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)