SGN Marker T0804

SGN-M1613
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TMEBA53TH
Arabidopsis best BAC match: AB026637.1
Arabidopsis position: 5.1940000
Arabidopsis identities: 0.902
Best GenBank protein hit: BAA98121.1
Evalue: 3.5e-22
Identities: 0.892
Description: "pyruvate dehydrogenase E1 component beta subunit, mitochondrial precursor (PDHE1-B) [Arabidopsis thaliana]"
Comment: in glycolysis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39864)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0804 was used as an overgo probe on plate 11 [well D2]

Plausible BAC Matches:   P148G24

 Overgo Sequences

A sequence
CACCAGTTGAGAGGATATCAGGTG
B sequence
GGCATAGGAACATCAGCACCTGAT
AB sequence
CACCAGTTGAGAGGATATCAGGTGCTGATG
Marker sequence
GAAATCTGTGCATCTGTGGTTGAGGAGAGCTTTGAGTATCTTGATGCACC
AGTTGAGAGGATATCAGGTGCTGATGTTCCTATGCCATACGCTGCTAATC
TTGAAAGACTGGCTGTTCCACAGGTAGAGGACATCGTTCGTGCAGTCAAG
AGGGTTTGTTACCGATCAAGTAAATAGATCATTTCCAATGGCTGCAGCTG
CTTAGGCTTGGTCCAGCGATGCCTTGATTGTTCCAAAGCATTTAACTTCT
ATTTGTGGATATCAATTCTTTATCCGCCTATAAGCGTATGCTTTCAGCCA
TCTTCTGGGAAGTTCAATTGACTGTAAAACCAGCCAAACTGGTAAACTAA
CGAATGAAATCTGCTGCCAGATTTTTCGGCCACGCAAGGAAATAGTTCTT
GTAGAAAATAATACTTAACAGCTTTTTTCCCTTAAAGAAAATGTTGTTAC
AAGAGAAAACAAAAAAAAAAAAAAAAAAACTCGAACTAGTTCGCTCTCTC
TCTCCACTGGATATATTGACTATGACCAGCTCGAGAAAAGTGCCACGATT
CTCTCATGAGGTTTTAATAATGCAGTGTAAACATGAAAATTAGCGG
Genomic location of T0804  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1613 marker 1613
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)