SGN Marker T0810

SGN-M1617
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBA69TH
Arabidopsis best BAC match: AC007651.2
Arabidopsis position: 1.0442000
Arabidopsis identities: 0.679
Best GenBank protein hit: BAA96146.1
Evalue: 2.3e-66
Identities: 0.652
Description: Similar to Mus musculus mRNA for heme-binding protein (AB013095) [Oryza sativa]/significance to MM?
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39438)
Chromosome
7
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0810 was used as an overgo probe on plate 8 [well C6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGTATTGCTGGCACTAATTGGGC
B sequence
TTTGTCGATGGCTGCTGCCCAATT
AB sequence
CAGTATTGCTGGCACTAATTGGGCAGCAGC
Marker sequence
GTTTGTTTCTGTTCCTTGTTTCCAAATTATGCAATGGTTACTCAACAAAG
TTGAATTTCTATCCTCCAACTTGTCAAAGAATTGAATGCCCAAATTATGA
TTTGATTGAATCTGGAAAAGACTATGAAATTCGTCGTTACGATTCCCCTA
TGTGGATGTCTACTGCTCCTATTGATGATATTTCATATGTTTCCGCCACC
AGAACTGGTTTCCTCAGGCTATTTGATTACATTCAAGGGAAGAATAAGTA
CCATGAGACAGTAAAGATGACAGCTCCAGTTATCATTCAAGTGAAGCCAA
GTGATGGACCTTTTTGTGCTTCTTCATTTGTTGTGAGTTTTTATGTACCA
AAGAAGAACCAGCCAAATCCTCCTCCAGCTAAAGGCCTTCATCTCCAGAA
ATGGGGGGACACTTACGTCGCGGTCAGGCAATTCAGTGGATTTATAGCTG
ATGATGACCTTCCAAGAGAAGCCGCTGCCCTGAGTGCCAGTATTGCTGGC
ACTAATTGGGCAGCAGCCATCGACAAAAGCCATGCTGCAGACAATACAAC
GTTGTATACAGTGGCGGGATACAACTCCCCATTTGAGTTCAAGAACAGAG
TTAATGAGATATGGTTTACTTTTGATTTGGAAAAAGCACTTGCCATTTGA
AAGGCTGCTTTTGTTACTACTTATCAAA
Genomic location of T0810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1617 marker 1617
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)