SGN Marker T0891

SGN-M1656
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAO95TH
Arabidopsis best BAC match: AB016886.1
Arabidopsis position: 5.1710000
Arabidopsis identities: 0.758
Best GenBank protein hit: BAB11325.1
Evalue: 8.8e-74
Identities: 0.794
Description: similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49573)
Chromosome
4
Position
5.48 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47507)
Chromosome
4
Position
38.81 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39455)
Chromosome
4
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0891 was used as an overgo probe on plate 7 [well F10]

Plausible BAC Matches:   P290O22

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGTGGAGGCGACAAAACATCACAG
B sequence
CATGAGTGGTACACCTCTGTGATG
AB sequence
AGTGGAGGCGACAAAACATCACAGAGGTGT
Marker sequence
GGAGAAAGCTTTCATCGGTTTGACCGCTACCTCAACTTCTCAAATCCTCT
GATCTCTGAAAATTTTGATCCTCGTGCTTGTGGTTGGGCATTTGGAATGA
ACATCATTGATCTAAATGAGTGGAGGCGACAAAACATCACAGAGGTGTAC
CACTCATGGCAAAATCGGAATCATGAAAGACAACTTTGGAAGTTGGGGAC
CCTACCACCTGGTTTGATAACCTTTTGGAAGCGCACATATGCCCTTGACC
GATCATGGCATGTCCTTGGACTTGGCTACAATCCAAATGTTAGCCAGAAG
GACATCCAACGAGCAGCAGTCATACACTACAATGGAAACTTGAAACCATG
GCTTGAAATAAGCATACCCAAGTTCCGGGACTACTGGTCAAAATTTGTTG
ACTATGATCAGACATTTTTGCGAGAGTGTAATATCAACAAATTGGGTGGT
TCATGAAGTGTTCTCTGCACATATTTCTCCTAATTCCTGAAATACAGCGA
GCAAGCATTTGTTTAGTTTACAGGTCC
Genomic location of T0891  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1656 marker 1656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)