SGN Marker TG180

SGN-M166

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1110
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGGTTGAAAATCTCAGTGGACTAAGGGGTCATTATACTTCTTTACAGGAACAGCTCACTTCTTCAAGAGTAAGTCTTTGATTAGTTGTTT
CTTCTGCTTTTGTTATTAAAGTTGCTTGCATCACCAGTGATACTTTCATGAACTTTAAGCTTCATTCAGGAACATTTAAACACCTTTGAA
TGTTTGTTTTGTTCATTTCTGCAAACTGTCCAGAGTAGTATTGTTTTACAACTCTTTTCAGATTTTTGAATGATGGTTTATGAATATTAT
AGATGTTTTTTCTCTCATTTTCTGCTTGATGATGGTGTTCCATGCATTCTAATCGGGTGATTAATTTAATGATTTTATTTGGGGCTTTCA
TGATATGTAA
Reverse sequence
AAAACTCTAATGTTGCCTTTCAATTCCTGCATTGGCAGAAGATTCAGAATGAACATCTAAATTTTTAATCCAAAAGTCAATTTAAGGTAG
ATTCACATTAGTGATCATAAAGTACCAGAATAGTATTGTGCAGTTTTTTACGCAGTTTCTCTCCTTCAACAATTTTAGTTTCGGCATAAG
CAAGACGGCTCTGCAAGTCGAAAATAACATTCTTCTGCTCTTCATATTCTTCTTTTGTCCTCACAGCAGACATGTCGGACATCTAACAAA
GTGATTAAACATTTGAAATATTTGAGAAATATATCTTCTAAAAGCTCGTTGGATATTACACGGTAAATTCAAACAAACAAGGGTCATAGA
AATGCTGTCACCTCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1680082.7e-0873 (19.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53520)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53204)
Chromosome
12
Position
42.32 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Pepper-COSII   
Map version
58 (location: 41627)
Chromosome
9
Position
47.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43593
Forward primer (5'-3')
AGCTGTTTCTTCTGCTTTGTTG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TTTGATGTGCGTGTGTGTGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40842)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36574
Forward primer (5'-3')
TCTCAGTGGACTAAGGGGTCA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GCATGGAACACCATCATCAA
Digested band sizes (using DraI)
Solanum pennellii TA56
421
Solanum lycopersicum TA209
570
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39928)
Chromosome
12
Position
9.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8389)
Chromosome
12
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8390)
Chromosome
12
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8394)
Chromosome
12
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 13995
Forward primer (5'-3')
TCTCAGTGGACTAAGGGGTCA
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCACAGCAGACATGTCGGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13995
Forward primer (5'-3')
TCTCAGTGGACTAAGGGGTCA
Digested band sizes (using DraI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCACAGCAGACATGTCGGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 146
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 1000
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG180 was used as an overgo probe on plate 1 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTGCTTGATGATGGTGTTCCATG
B sequence
TCACCCGATTAGAATGCATGGAAC
AB sequence
TCTGCTTGATGATGGTGTTCCATGCATTCT
Marker sequence
TGGTTGAAAATCTCAGTGGACTAAGGGGTCATTATACTTCTTTACAGGAA
CAGCTCACTTCTTCAAGAGTAAGTCTTTGATTAGTTGTTTCTTCTGCTTT
TGTTATTAAAGTTGCTTGCATCACCAGTGATACTTTCATGAACTTTAAGC
TTCATTCAGGAACATTTAAACACCTTTGAATGTTTGTTTTGTTCATTTCT
GCAAACTGTCCAGAGTAGTATTGTTTTACAACTCTTTTCAGATTTTTGAA
TGATGGTTTATGAATATTATAGATGTTTTTTCTCTCATTTTCTGCTTGAT
GATGGTGTTCCATGCATTCTAATCGGGTGATTAATTTAATGATTTTATTT
GGGGCTTTCATGATATGTAA
Genomic location of TG180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D166 marker 166
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)