SGN Marker T0966

SGN-M1687
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAV47TH
Arabidopsis best BAC match: AB024036.1
Arabidopsis position: 3.0580000
Arabidopsis identities: 0.659
Best GenBank protein hit: BAB02821.1
Evalue: 7.7e-49
Identities: 0.711
Description: contains similarity to protein translation inhibitor [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49575)
Chromosome
7
Position
63.90 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47509)
Chromosome
7
Position
77.48 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39885)
Chromosome
7
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0966 was used as an overgo probe on plate 7 [well B11]

Plausible BAC Matches:   P059P18,   P184F14,   P146A18

 Overgo Sequences

A sequence
AATTCGCGCGTTCCTTTCGTTTGC
B sequence
TACCGGTACTGGCTAAGCAAACGA
AB sequence
AATTCGCGCGTTCCTTTCGTTTGCTTAGCC
Marker sequence
TGGCTGCAAACGCCGGGCACAACCGTACTCCGATGGCCATCGGAATTGGA
CGCGTGTCAGTTGCTAATTCGCGCGTTCCTTTCGTTTGCTTAGCCAGTAC
CGGTAAAAAGGAGGAAATTAGTACAGATAAGGCACCAGCTGCAGTGGGCC
CATATTCTCAAGGAATTAAGGCTAATAATTTCATTTATGTATCTGGTTCT
CTAGGTCTTATTCCTGAGACTGGAGAACTCATATCAGACAATGTGGAGGA
TCAAACAGAACAGGCTCTGAAAAATATTGGGGAGATACTTAAAGCTGGCG
GTGTTAGCTATTCTGCAGCTGTTAAAACAACAATTATGTTGGCTGATCTA
GGGGACTTTCAGAAAGTCAATGCAATTTATGCTAAATATTTTCCAGATCC
TGCACCAGCACGTTCAACTTTTCAAGCAGCAGGATTACCTCTGAATGCAA
AAATTGAAATTGATTGCATAGCAGTGTGTTAAACAGATTAAAGTCTTCAA
CTTCCATGGCAGCTATGACTTTAGATTCAAAAATTAAAGTTAAATAAAGG
AGATTTAAGTCTTTAATTCAGAGTCTCTTGATACTCTGCTGCAGATTCTA
ATCT
Genomic location of T0966  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1687 marker 1687
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)