SGN Marker T1045

SGN-M1721
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA06TH
Arabidopsis best BAC match: AL078467.1
Arabidopsis position: 4.1400000
Arabidopsis identities: 0.784
Best GenBank protein hit: CAB81395.1
Evalue: 4.7e-55
Identities: 0.603
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39468)
Chromosome
12
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1045 was used as an overgo probe on plate 4 [well F8]

Plausible BAC Matches:   P196J23,   P161H10,   P179P09,   P017D16,   P146I24,   P208B09,   P132B08,   P235C08

 Non-Plausible BAC matches

P099L08,   P090H01,   P218M01,   P033A13,   P017I24,   P281B12,   P180J10,   P294A09,   P201G12,   P180P04

 Overgo Sequences

A sequence
GCTAGTCATTGAAGCCTACAGGAC
B sequence
TCCCCTGTCTCTAAGTGTCCTGTA
AB sequence
GCTAGTCATTGAAGCCTACAGGACACTTAG
Marker sequence
CAAACGATGTTGGCTATATTTCACAAGGCATTTGCTCATCCTCCTGAAGA
ATTAAATAGTCCTGCATCAAAAAAATGTTTACTTCCACAACAAACGCTAC
AAAAATTCGTATCGACTCGTCCATTTGACACCTCTTATGTTACTTTTGGA
GATGTTGCTGCTCTTGCTTTTGTTCGTCCTAATTGCACCTCCTTGCTCAA
TCACAAACAAAGGTATTTTTGTGGGTATGATGATATTTACTGTTTGTTCA
TGGGGAGTTTGAACAATTTGTGTGCACAAATCAAACAATATGGGCTATCA
CCAAAAGGTACAAATGAAGCCATGCTAGTCATTGAAGCCTACAGGACACT
TAGAGACAGGGGACCTTATCCAGCTGATCAAGTTATTAAGGATTTTGAAG
GAAGNTTTGCTTTTGTTATCTATGATAGTAAAACTGGAACTGTATTTGTT
GCTTTGGGTTCAAATGGTGGGGGGAAGNTATTTTGGGGTATTGCTGCT
Genomic location of T1045  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1721 marker 1721
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)