SGN Marker solcap_snp_sl_100007

SGN-M17595

Synonyms  
1863_3_229_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53926)
Chromosome
6
Position
37.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAATATAGTCCATAAAAGACAATGTGGAAGGGACTCGGTGGAAATGGTTC
  
3' flanking region
ATGAGAAAGTAGTTTGGTTTTCTATTTGGCAAAAGAACAATGATATGGTT
SNP nucleotide
AG
SNPdb format
GAATATAGTCCATAAAAGACAATGTGGAAGGGACTCGGTGGAAATGGTTC[A/G]
ATGAGAAAGTAGTTTGGTTTTCTATTTGGCAAAAGAACAATGATATGGTT
  
Genomic location of solcap_snp_sl_100007  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17595 marker 17595
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)