SGN Marker solcap_snp_sl_100156

SGN-M17736

Synonyms  
CL009261-0270
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54067)
Chromosome
4
Position
63.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATTACAGAGGATCTGGTTTATANTTGTCTCTTCTATGGTTACTTCTAAATACTTTTCCTTTGCACTTTTCTATGGATAATAGANATTATTGATAAATT
  
3' flanking region
TACGAGAAGGTTCGTTCTGGTGATTCTACATTTGATGCTGATGAAGAGAGCAAATGGCGCAAGTATGCACTTCTTCTTCCATTTATGACTTTTCCATAG
SNP nucleotide
AG
SNPdb format
GGATTACAGAGGATCTGGTTTATANTTGTCTCTTCTATGGTTACTTCTAAATACTTTTCCTTTGCACTTTTCTATGGATAATAGANATTATTGATAAATT[A/G]
TACGAGAAGGTTCGTTCTGGTGATTCTACATTTGATGCTGATGAAGAGAGCAAATGGCGCAAGTATGCACTTCTTCTTCCATTTATGACTTTTCCATAG
  
Genomic location of solcap_snp_sl_100156  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17736 marker 17736
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)