SGN Marker T1118

SGN-M1775
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.01
Tomato EST read: TFBBA94TH
Arabidopsis best BAC match: AC000132.1
Arabidopsis position: 1.0270000
Arabidopsis identities: 0.785
Best GenBank protein hit: AAB60737.1
Evalue: 2.2e-30
Identities: 0.510
Description: Identical to A. thaliana PUR2 (gb|X74766). ESTs [Arabidopsis thaliana]
Comment: glycinamide ribonucleotide synthetase: one of three purine biosynthetic enzymes
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39507)
Chromosome
1
Position
129.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1118 was used as an overgo probe on plate 8 [well G2]

Plausible BAC Matches:   P102N10

 Non-Plausible BAC matches

P026N10,   P315K20,   P307M14,   P201L04,   P024O06

 Overgo Sequences

A sequence
TGGTAATTGGAGGAGGTGGGAGAG
B sequence
TGACAAAGCGCATGCTCTCTCCCA
AB sequence
TGGTAATTGGAGGAGGTGGGAGAGAGCATG
Marker sequence
TGGCATGTATGTCACTCAATATAGGAGCTGCTTCTGCTTTGAAGTTTGTA
AGCAATTCCCAAAATCATCCAGTAAAGCTGTTCTCGGCTAAAGAACAACG
TTGTTCCAACTTCAGTTCCAGCAATTGGGGTTGTTTCAGTCTTCGAGTTC
GTCGGAGTTCTTGCCTTCGTTTTGATACACAAAAATCTTTCGCCGTTTTC
AACAGCCTTCCAGTGGATAATAGCAACCCCAAAGAAAGTGTGGTTGTCTT
GGTAATTGGAGGAGGTGGGAGAGAGCATGCGCTTTGTCATGCTTTGAGGC
GATCCCCTTCTTGTGACGCTATTTTCTGTGCACCGGGTAATGCTGGAATT
TCCAGCTCAGGTGATGCGACTTGTATATCAGACCTTGATGTTTTAGATAG
TTCAGCTGTGATTGCTTTCTGTCCTAAATGGGGAGTTGGAC
Genomic location of T1118  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1775 marker 1775
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)