SGN Marker T1119

SGN-M1776
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.03
Tomato EST read: TFBBA96TH
Arabidopsis best BAC match: AB025622.1
Arabidopsis position: 5.2090000
Arabidopsis identities: 0.951
Best GenBank protein hit: BAB08421.1
Evalue: 5.9e-59
Identities: 0.931
Description: polypyrimidine tract-binding RNA transport protein-like [Arabidopsis thaliana]
Comment: polypyrimidine tract binding factor U2AFlikely involved in intron splicing
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39508)
Chromosome
3
Position
45.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1119 was used as an overgo probe on plate 2 [well G5]

Plausible BAC Matches:   P270F24,   P264F02

 Overgo Sequences

A sequence
TGTAGTTCGGATGGCATCTGCATC
B sequence
AAACTGAGGCTGGCTAGATGCAGA
AB sequence
TGTAGTTCGGATGGCATCTGCATCTAGCCA
Marker sequence
CAGTTCATCTAACTCGTCGGCTGGGCATCTCATCTACTCGGCGTTGTTGT
GCGGTGGTTCCGTCGGTGAAACCCTAATTTCTGATAACATCCGCTTAACC
TAGCTTGGTTTGTAGTTCGGATGGCATCTGCATCTAGCCAGCCTCAGTTT
CGATACACACAACCCCCATCAAAGGTCCTTCATTTGAGAAACTTACCATG
GGAGTGCACAGAGGAGGAGCTGATCGAATTGGGAAAACCTTTTGGTAGAG
TTGTGAATACCAAGTGTAATGTAGGAGCAAACCGAAATCAAGCATTTATA
GAGTTTGCAGAATTAAATCAAGCCATTGCAATGATATCGTACTATGCCTC
TTCCTCTGAACCAGCTCAAGTACGGGGGAAAACCGTCTACCTACAATATT
CCAACAGGCAAGAGATAGTGAACAACAAAACTACAGCAGATGTAGCTGGA
AATGTGTTGTTGGTTACAATTGAAGGAAATGATGCTCGCCTTGTCAGCAT
TGATGTTTTACACTT
Genomic location of T1119  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1776 marker 1776
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)