SGN Marker solcap_snp_sl_100244

SGN-M17814

Synonyms  
CL015472-0201
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54145)
Chromosome
4
Position
61.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCAAATCAAGAATTCAGAAGCATCAGTCTACTGTTTTTCGAACGAACATGCCACCAGGTCCATTCATTTCATTCAATCCAAACGTTGTTGTTTTGCT
  
3' flanking region
GATGGTAAAAGTTTCCCCNTNCTTTTTGATGTATCNAAAGTTGAAAAAAAGGATCTTTTCACCGGTACTTTCATGCCATCCACTGATCTCACAGGCGGTT
SNP nucleotide
AC
SNPdb format
TTCAAATCAAGAATTCAGAAGCATCAGTCTACTGTTTTTCGAACGAACATGCCACCAGGTCCATTCATTTCATTCAATCCAAACGTTGTTGTTTTGCT[A/C]
GATGGTAAAAGTTTCCCCNTNCTTTTTGATGTATCNAAAGTTGAAAAAAAGGATCTTTTCACCGGTACTTTCATGCCATCCACTGATCTCACAGGCGGTT
  
Genomic location of solcap_snp_sl_100244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17814 marker 17814
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)