SGN Marker solcap_snp_sl_100458

SGN-M18013

Synonyms  
CL016760-0427
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54344)
Chromosome
3
Position
52.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTGTCNTTTAGGACCAAAGGTTTCACNATCTATCATATCGGACCTATTGGGTGTATGTNTGACTTNGCTAAAGGAATTTCACTTTCAATNTACTGATGN
  
3' flanking region
CGTGGTTGTGCATTTTGGTCAATACCGTGGTGATATCTTGAAAATCTCTTCTTGATATAGTTCTGGTTTCTCTTTCAATGTGTAGATATACGTCATTATG
SNP nucleotide
TG
SNPdb format
AGTGTCNTTTAGGACCAAAGGTTTCACNATCTATCATATCGGACCTATTGGGTGTATGTNTGACTTNGCTAAAGGAATTTCACTTTCAATNTACTGATGN[T/G]
CGTGGTTGTGCATTTTGGTCAATACCGTGGTGATATCTTGAAAATCTCTTCTTGATATAGTTCTGGTTTCTCTTTCAATGTGTAGATATACGTCATTATG
  
Genomic location of solcap_snp_sl_100458  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18013 marker 18013
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)